Slit-robo gtpase-activating protein 2 as a metastasis suppressor in osteosarcoma

ABSTRACT Osteosarcoma is the most common primary bone tumor, with metastatic disease responsible for most treatment failure and patient death. A forward genetic screen utilizing _Sleeping

Beauty_ mutagenesis in mice previously identified potential genetic drivers of osteosarcoma metastasis, including Slit-Robo GTPase-Activating Protein 2 (_Srgap2_). This study evaluates the

potential role of SRGAP2 in metastases-associated properties of osteosarcoma cell lines through _Srgap2_ knockout via the CRISPR/Cas9 nuclease system and conditional overexpression in the

murine osteosarcoma cell lines K12 and K7M2. Proliferation, migration, and anchorage independent growth were evaluated. RNA sequencing and immunohistochemistry of human osteosarcoma tissue

samples were used to further evaluate the potential role of the Slit-Robo pathway in osteosarcoma. The effects of _Srgap2_ expression modulation in the murine OS cell lines support the

hypothesis that SRGAP2 may have a role as a suppressor of metastases in osteosarcoma. Additionally, _SRGAP2_ and other genes in the Slit-Robo pathway have altered transcript levels in a

subset of mouse and human osteosarcoma, and SRGAP2 protein expression is reduced or absent in a subset of primary tumor samples. SRGAP2 and other axon guidance proteins likely play a role in

osteosarcoma metastasis, with loss of SRGAP2 potentially contributing to a more aggressive phenotype. SIMILAR CONTENT BEING VIEWED BY OTHERS A CALPAIN-6/YAP AXIS IN SARCOMA STEM CELLS THAT

DRIVES THE OUTGROWTH OF TUMORS AND METASTASES Article Open access 24 September 2022 LOW EXPRESSION OF ZFP36L1 IN OSTEOSARCOMA PROMOTES LUNG METASTASIS BY INHIBITING THE SDC4-TGF-Β SIGNALING

FEEDBACK LOOP Article Open access 07 November 2023 THE ZINC FINGER PROTEIN560(ZNF560) FUNCTIONS AS A NOVEL ONCOGENIC GENE IN OSTEOSARCOMA Article Open access 02 January 2025 INTRODUCTION

Malignant bone tumors comprise the eighth most common type of pediatric cancer in the United States, with the majority being osteosarcoma1,2. Osteosarcoma has a bimodal age distribution,

with the first and primary peak incidence in adolescence and a second smaller peak incidence starting in the sixth decade of life2. Osteosarcoma survival dramatically improved with the

introduction of high-dose chemotherapy into treatment regiments in the 1970’s3. However, the 5-year survival rate has remained around 60% for the past four decades despite advanced surgical

techniques and numerous clinical trials3,4. Metastatic disease, which typically occurs in the lungs, is the main cause of treatment failure and patient death. Targeted therapeutics are

needed to improve patient survival beyond what can be offered by surgery and non-specific chemotherapy. Osteosarcoma has a high tendency for aneuploidy, chromothripsis, and kataegis, all

indicative of chromosomal instability5,6,7. Given the complex chromosomal changes acquired through genomic instability, identifying specific genes involved in osteosarcoma tumorigenesis and

progression is challenging. Little overlap between potential drivers of osteosarcoma exists between genetic studies of primary tumors owing to the complexity and the heterogeneity in

osteosarcoma. To address this, a forward genetic screen of osteosarcoma utilizing the _Sleeping Beauty_ mutagenesis system was previously conducted to identify potential drivers of

osteosarcoma development and metastasis8. The _Sleeping Beauty_ mutagenesis screen identified 232 sites associated with osteosarcoma development and 43 sites associated with metastasis.

Slit-Robo GTPase-Activating Protein 2 (_Srgap2_) was the most frequently mutated gene in metastatic nodules after _Pten (Srgap2_: n = 6/19 animals with metastasis, 31%). Primary tumors were

evaluated from mice with a _Trp53_ deficient background in addition to transposon mutagenesis and from mice with transposon mutagenesis alone. _Srgap2_ had the fifth most insertions in

primary tumors (n = 13/96, 13.5%) within the subgroup of mice on a _Trp53_ deficient background in addition to transposon mutagenesis. The physiological roles of SRGAP2 have primarily been

studied in the context of cortical neuron function9,10,11,12. SRGAP2 has three domains: an SH3 domain by which it binds Robo proteins embedded in cellular membranes13, an F-BAR domain

through which it induces filopodia formation9,11,12, and a Rho-GAP domain that activates the GTPase of the F-actin modulating Rho-GAP protein Rac19,14. _SRGAP2_ underwent 3 duplication

events throughout evolution in the human species, creating _SRGAP2B, SRGAP2C,_ and _SRGAP2D_, which are truncated versions of the full-length gene sharing 99% sequence similarity15. SRGAP2B

and SRGAP2C have been shown to act as dominant negative inhibitors of SRGAP2 in laboratory experiments10; however, _SRGAP2B_ is predicted to produce mostly isoforms with premature stop

codons, rendering the protein product non-functional15. _SRGAP2D_ also has a premature stop codon and its product is predicted to undergo nonsense mediated decay15. In population studies,

_SRGAP2_ and _SRGAP2C_ have a fixed diploid copy number, whereas _SRGAP2B_ and _SRGAP2D_ vary from 0 to 4 copies, which is further evidence of the more critical physiological role of SRGAP2

and SRGAP2C compared to SRGAP2B and SRGAP2D15. Knockdown of _SRGAP2_ or expression of the dominant negative SRGAP2C has revealed an increase in neuron migration through mouse brain slices

electroporated _ex vivo_, whereas over-expression of SRGAP2 encourages neurite outgrowth and branching, thereby decreasing neuron migration9,10. SRGAP2 has been shown to induce similar

phenotypes in the human colon cancer HCT116 cell line _in vitro_16, supporting the potential role of acting as a suppressor of migration in the context of cancer. Here we functionally

evaluate the potential role of SRGAP2 in osteosarcoma development and metastasis. RESULTS SLEEPING BEAUTY FORWARD GENETIC SCREEN IMPLICATES SRGAP2 AS A TUMOR AND METASTASIS SUPPRESSOR GENE

_Srgap2_ was recurrently mutated in four _Sleeping Beauty_ screens documented in the Candidate Cancer Gene Database, a database of cancer driver genes from _Sleeping Beauty_ transposon based

forward genetic screens in mice17. Our prior osteosarcoma8 and malignant peripheral nerve sheath tumor18 screens predicted a disrupted gene function (Supplementary Table S1). The chronic

myeloid leukemia19and medulloblastoma20 screens did not evaluate the predicted effect on gene function. The percent of primary tumors with an insertion in _Srgap2_ ranged from 13.5% in

osteosarcoma to 30% in chronic myeloid leukemia (Supplementary Table S1). The mutagenic transposons used in the _Sleeping Beauty_ screens can disrupt gene transcription in either

orientation, but can only promote gene transcription in one direction8. The insertion locations and the promoter direction of transposons within _Srgap2_ in the primary osteosarcoma tumors

and metastatic nodules reveal a profile indicative of a tumor suppressor gene: the transposons are inserted throughout the gene without a bias in promoter orientation (Fig. 1). Insertions

were found in 15 primary tumors from mice with and without a _Trp53_ deficient background in addition to transposon mutagenesis (n = 119). RNA sequencing was performed on most primary tumor

samples from the osteosarcoma screen (n = 105/119) and mapped using a modified genome containing a _Sleeping Beauty_ chromosome with the T2/Onc sequence21. Ten samples were found to contain

reads in _Srgap2_ paired to reads in the transposon sequence. Evaluation of the mapping patterns around the insertion sites was used to determine the impact of the transposon insertion on

_Srgap2_ expression. Of the 10 samples, 7 appeared to result in a substantial reduction in normal _Srgap2_ expression (Supplementary Table S2). These data suggest that loss of _Srgap2_ may

be involved in tumor formation in a subset of _Sleeping Beauty_ induced murine osteosarcoma. To functionally evaluate the potential role of Srgap2 in osteosarcoma development and metastasis,

we overexpressed and knocked out _Srgap2_ in murine osteosarcoma cell lines. OVEREXPRESSION AND KNOCKOUT OF SRGAP2 IN MURINE OSTEOSARCOMA CELL LINES The murine genome only contains the

mouse ortholog of the ancestral _SRGAP2_ gene, which has a 98% amino acid similarity to human _SRGAP2._ Expression of the human ancestral gene has been shown to induce consistent phenotypes

in murine cells10. The murine osteosarcoma cell lines K12, created from a spontaneous tumor, and a highly metastatic derivative called K7M2, created through _in vivo_ passaging, were used in

this study22 _SRGAP2_ overexpression was achieved with doxycycline inducible _PiggyBac_ vectors containing human _SRGAP2_ cDNA. _Srgap2_ knockout was accomplished using the CRISPR/Cas9

system. The K12 knockout (KO) cell line has half the expression of _Srgap2_ mRNA compared to parent and luciferase controls (qPCR) (Fig. 2a). Genomic sequencing of the targeted exon in the

K12 KO line showed deletions and insertions in half of the sequencing samples (Supplementary Fig. 1). The K7M2 KO has no detectable expression of _Srgap2_ mRNA compared the parent and

luciferase controls (qPCR) (Fig. 2b), and genomic sequencing showed deletions and insertions in all of the samples (Supplementary Fig. 1). This data suggest that K12 most likely has

heterozygous knockout of _Srgap2_, whereas K7M2 has homozygous knockout of _Srgap2._ Overexpression of human _SRGAP2_ cDNA was accomplished by the addition of doxycycline to cell lines

stably expressing a tetracycline-responsive promoter driving the expression of _SRGAP2_. The level of _SRGAP2_ mRNA expression in the K12 and K7M2 overexpression (OE) cell lines exposed to

doxycycline is at least doubled by qPCR compared to overexpression lines without doxycycline (Fig. 2a,b). Expression of the human _SRGAP2_ transgene in the K12 OE and K7M2 OE cell lines was

further evaluated by Western blotting (Fig. 2c,d). Numerous commercial antibodies were tried against the murine lysates, but none could detect endogenous murine SRGAP2 in wild type lysates,

as demonstrated by the OE –dox lysates in Fig. 2b. Western blotting could, therefore, not be used to assess _Srgap2_ knockout in the murine cell lines. Four bands were observed in the K12 OE

cell line and three bands in the K7M2 OE cell line with induced human _SRGAP2_ expression (140 KDa: SRGAP2, 120 KDa: unknown, 100 KDa in K12 OE: unknown, 42 KDa: beta-actin). SRGAP2 has a

predicted molecular weight of 121 KDa, but most antibodies, including the Abcam antibody (#ab121977) used here, detect a band at 140 KDa. A separate group working on SRGAP2 noted a second

band of slightly lower molecular weight on Western blotting that was described as non-specific binding23. A similar band was observed around 120 KDa in this work when doxycycline was

administered to induce expression of the human _SRGAP2_ transgene. It is possible that the two bands represent different products of the _SRGAP2_ gene, with the 140 KDA band representing a

post-translationally modified form of SRGAP2. Another unknown band around 100 KDa was also observed in the K12 murine OE cell line. The appearance of this band when the cells are treated

with doxycycline to induce expression of the human SRGAP2 protein suggests there may be an alternative in-frame ATG start codon or that it is a degradation product of SRGAP2. SRGAP2

EXPRESSION AFFECTS _IN VITRO_ PROLIFERATION AND MIGRATION BUT NOT ANCHORAGE INDEPENDENT GROWTH IN MURINE OSTEOSARCOMA CELL LINES Cell densities and rates of proliferation for the K12 and

K7M2 _Srgap2_ KO, _SRGAP2_ OE, and control cell lines were compared at 24, 48, 72, and 96 hours post plating. K12 parent and K7M2 luciferase with and without doxycycline are shown as the

control lines. The luciferase and parent cell lines behaved similarly in all assays. A p-value of statistical difference was found by ANOVA at all time points, indicating variance among the

K12 and the K7M2 cell lines (Supplementary Table S3). The addition of doxycycline to induce _SRGAP2_ expression in the OE cell lines did not substantially affect proliferation (Fig. 3a). The

K7M2 KO showed significantly less proliferation compared to control at all time points (p < 0.0001). The K7M2 KO grew slower at the early time points, but the proliferation rate

increased between 72 and 96 hours (fold change, Supplementary Table S3). The K12 KO showed significantly less proliferation compared to control at 96 hours (p < 0.0001). However, the K12

KO had a linear growth rate and the fold change in absorbance was lower than the control cell lines at all time points (fold change, Supplementary Table S3). These data suggest that SRGAP2

may reduce cellular proliferation. Enforced _SRGAP2_ expression at high levels slowed the migration of both K12 (p = 0.001) and K7M2 (p = 0.02) OE cell lines in wound healing assays (Fig.

3b). Although a difference was also observed in the K7M2 control with the addition doxycycline (p = 0.04), the phenotypic effect was opposite that of the OE line with doxycycline. The

presence of doxycycline likely did not directly contribute to the observed difference in migration. Knockout of _Srgap2_ increased cellular migration of the less aggressive K12 cell line (p 

< 0.0001) but did not have an effect on migration in the K7M2 cell line. Anchorage independent cell growth was suppressed when _SRGAP2_ expression was induced in the K7M2 OE cell line (p 

< 0.0001) (Fig. 3c). All other K12 and K7M2 cell lines had similar performance in anchorage independent growth. EXPRESSION OF SRGAP2 AND OTHER GENES IN THE SLIT-ROBO PATHWAY ARE ALTERED

IN HUMAN OSTEOSARCOMA SAMPLES To evaluate SRGAP2’s role in human osteosarcoma, mRNA expression levels of genes associated with the Slit-Robo pathway were evaluated in 12 juvenile

osteosarcoma samples for which RNA sequencing data were available (Supplementary Table S5)7. The list of genes was compiled from pathway information for SRGAP2 provided by Gene Cards

(www.genecards.org). Metastatic samples had either 1.8 greater _SRGAP2C_: _SRGAP2_ transcript ratio (n = 2) (Fig. 4a) or a two-fold reduction of _ENAH_ compared to primary osteosarcoma

samples (n = 5) (Fig. 4b). On average the _SRGAP2C: SRGAP2_ expression ratio was similar among osteoblasts, primary osteosarcoma samples, and metastatic osteosarcoma samples (Fig. 4c). The

level of _ENAH_ expression, however, was significantly reduced in the metastatic osteosarcoma samples compared the osteoblasts (p = 0.0002) and primary osteosarcoma samples (p = 0.004).

(Fig. 4d). Like SRGAP2, ENAH is an actin-associated protein involved in cytoskeleton remodeling, including lamellipodia and filopodia dynamics. These data demonstrate that _SRGAP2_ and other

genes in the Slit-Robo pathway may play a role in tumor formation in a subset of human osteosarcoma. Immunohistochemistry (IHC) and H&E staining was also performed on normal bone and

primary osteosarcoma samples from humans (US Biomax, Rockville) (Fig. 5). The protein fragment used to raise the polyclonal antibody has regions of homology with SRGAP1. We evaluated the

mRNA expression levels of SRGAP1 in the 12 juvenile osteosarcoma samples and osteoblast controls. While SRGAP1 is expressed in all of the samples, expression of SRGAP2 is on average 10 fold

greater than SRGAP1. Therefore the amount of signal attributed to SRGAP1 is predicted to be minimal. Mild to high immuoreactivity to anti-SRGAP2 antibody was observed in the periosteum of

normal bone and in low-grade osteosarcoma samples. In high-grade, stage II osteosarcoma samples, expression of SRGAP2 was substantially reduced or absent in over half of the samples (n = 

19/36). Patient characteristics and scoring for each sample are listed in Supplementary Table S4. THE SLIT-ROBO PATHWAY IS ALTERED IN SLEEPING BEAUTY DERIVED OSTEOSARCOMA Given the increased

expression of _ENAH_ in human osteosarcoma samples, transposon insertion profiles for _Enah_ were evaluated from the _Sleeping Beauty_ derived tumors. In addition, transposon insertion

profiles for _Slit2, Slit3_, and _Robo1_ were evaluated given their direct upstream role in _SRGAP2_ function. Insertions were found in primary tumors from animals with and without a _Trp53_

deficient background in addition to transposon mutagenesis (n = 119) and in metastatic nodules (n = 19 animals; all metastatic nodules from one animal were grouped). Seven primary tumors

(6%) and metastatic nodules from 4 animals (21%) had insertions in _Slit2_, 4 primary tumors (3%) and a metastatic nodule from one animal (5%) had insertions within _Slit3_, 3 primary tumors

(3%) had insertions within _Robo1_, and 3 primary tumors (3%) and a metastatic nodule from 1 animal (5%) had insertions within _Enah_ (Supplementary Fig. 2). In total, 28 primary tumors

(24%) and metastatic nodules from 10 animals (53%) had a transposon insertion in at least one of the genes involved in the Slit-Robo pathway that were evaluated. _SRGAP2C_ could not be

evaluated by the _Sleeping Beauty_ screen because it is only found in the human genome. DISCUSSION The nearly identical sequences shared between the ancestral and duplicated _SRGAP2_ genes

make it experimentally challenging to study _SRGAP2_ in human cells. The murine genome has the advantage of containing only the ancestral _Srgap2_ gene, which maintains a 98% amino acid

sequence similarity with the human _SRGAP2_ gene10. The data presented here support our hypothesis that SRGAP2 may have a role as a suppressor of metastases in osteosarcoma. Overexpression

of _SRGAP2_ reduced _in vitro_ migration rates in both K12 and K7M2 cell lines. Knockout of _Srgap2_ increased the _in vitro_ migration rate of the less aggressive K12 cell line but not

K7M2. It is possible the more aggressive K7M2 cell line already gained migration potential from another part of the Slit-Robo pathway or a parallel pathway when it was originally created.

Although overexpression of _SRGAP2_ also decreased the anchorage independent growth capacity of the K7M2 cell line, the absolute change may not be physiologically significant. Given the

changes observed in _Srgap2_ expression in a subset of primary tumors, it is possible that SRGAP2 also plays a role in primary tumor growth and later in metastasis. Unexpectedly, knockout of

_Srgap2_ slowed the proliferation of the K12 and K7M2 cell lines. This may be due to its role in F-actin dynamics. However, even with its affects on proliferation, _Srgap2_ KO cell lines

performed similarly to controls in the longer anchorage-independent growth assay. SRGAP2 primarily functions in membrane dynamics, inducing filopodia formation through

homodimerization9,11,12 and activating the GTPase of the F-actin modulating Rho-GAP protein Rac19,14. Other modulators of Rac1 have also been implicated in osteosarcoma metastasis. Micro-RNA

(miR)-142 has been shown to regulate Rac1 expression in osteosarcoma cell lines by targeting the 3’-untranslated region of the _SRGAP2_ transcript and blocking translation of the protein24.

Expression of miR-142 or direct silencing of Rac1 inhibited cellular invasion as well as cellular proliferation. In this work, the overexpression of _SRGAP2_ also slowed cellular migration

in murine osteosarcoma cell lines and the knockout of _Srgap2_ increased cellular migration in the K12 cell line. However, unlike what has been observed in other studies of SRGAP2, knockout

of _Srgap2_ slowed cellular proliferation in osteosarcoma cell lines16,24. In the _Sleeping Beauty_ osteosarcoma mutagenesis screen, an enrichment of genes involved in axon guidance was

found in pathway analysis of genes with high rates of transposon insertion8. SRGAP2 and SEMA4D have similar, but opposite effects on actin dynamics8,10,25. Unlike _SRGAP2_, the _SEMA4D_ and

_SEMA6D_ genes had increased expression in mouse osteosarcoma tumors from the _Sleeping Beauty_ screen and human osteosarcoma tissue samples8. Additionally, overexpression of _SEMA4D_ or

_SEMA6D_ increased proliferation, colony formation in soft agar, and xenograft formation in OS cell lines8. These findings agree with the different effects of SRGAP2 and SEMA4D/SEMA6D on

actin dynamics and further support the idea that genes involved in axon guidance have a role in metastatic osteosarcoma. In this study, an increased _SRGAP2C_: _SRGAP2_ transcript ratio or

decreased expression of _ENAH_ was found in all juvenile metastatic lesions (n = 7) compared to osteoblasts and primary tumor samples (n = 5). _ENAH-001_ was the only detectable _ENAH_

isoform in the St. Jude osteosarcoma7 and osteoblast control8 samples. The functions of SRGAP2, SRGAP2C, and ENAH are mediated by Slit-Robo signaling, but with different effects on cell

motility. SRGAP2 and ENAH block cellular migration, whereas SRGAP2C promotes cellular migration through the inhibition of SRGAP2 (Fig. 6). Expression of SRGAP2C has been shown to increase

motility in neuronal cells10 while decreasing ENAH-001 (Ensembl isoform designation) expression has been shown to increase motility in fibroblasts26,27. Transposon insertions were found in

_Srgap2, Enah, Slit2, Slit3_, or _Robo1_ in 24 percent of primary tumors from mice with _Sleeping Beauty_ derived osteosarcoma, further implicating the role of the Slit-Robo pathway in

osteosarcoma. The migration results from the murine cell lines generally support the hypothesis that SRGAP2 acts as a suppressor of migration. This study also found that _SRGAP2, SRGAP2C_,

and other genes in the Slit-Robo pathway have altered transcript levels in a subset of mouse and human osteosarcoma, and SRGAP2 protein expression is reduced or absent in half of primary

tumor samples. SRGAP2 and other axon guidance proteins likely play a role in osteosarcoma metastasis, with loss of SRGAP2 contributing to a more aggressive phenotype. Further study of the

axon guidance pathways may reveal new opportunities for osteosarcoma treatments. METHODS TRANSPOSON INTEGRATION SITE AND RNA SEQUENCING ANALYSIS OF SLEEPING BEAUTY DERIVED OSTEOSARCOMA The

Integrative Genomics Viewer (IGV)28,29 was used to analyze the _Srgap2_ insertion sites previously identified by Illumina sequencing in _Sleeping Beauty_ derived mouse osteosarcoma tumors

and metastatic nodules8. IGV was also used to analyze RNA sequencing data from 105 of the 119 _Sleeping Beauty_ derived primary tumors. The samples were mapped using a modified genome

containing a _Sleeping Beauty_ chromosome with the T2/Onc sequence21. CREATION AND MAINTENANCE OF CELL LINES K7M2 and K12 cell lines were a kind gift from Chand Khanna and cultured in DMEM

supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin. _Srgap2_ knockout was achieved using the CRISPR/Cas9 system (Addgene, Cambridge). A guide RNA (gRNA) was created to

target exon 6 in murine cell lines (gcattgaggagaagcatgtc). A previously described method of co-transposition was used to enhance screening for knockout clones30. Briefly, cells were

transfected with 2 μg Cas9 nuclease, 2 μg gRNA, 500 ng CMV-PB7 _PiggyBac_ transposase, and 500 ng CAGG-Luciferase-IRES-GFP-PGK-Puro _PiggyBac_ transposon for resistance to puromycin.

Electroporation was performed on one million cells in 100 μL of PBS using the NEON transfection system (Thermo Fisher, Waltham), following the manufacturer’s protocol. After two days of

incubation, cells were plated into 96 well plates at densities ranging from 50–1,000 cells per well. Puromycin was added at a concentration of 2 μg/mL of culture media, and wells later

growing single colonies were selected for knockout analysis. Conditional _PiggyBac_ vectors were utilized for _SRGAP2_ overexpression. _SRGAP2_ cDNA with the human sequence was transferred

into the previously described PB-TRE-DEST1-EF1A-rtTA-IRES-Puro by a standard LR Clonase reaction (Thermo Fisher), following manufacturer’s instruction18,30. Luciferase control cell lines

were created using the same CAGG-Luciferase-IRES-GFP-PGK-Puro _PiggyBac_ transposon for resistance to puromycin used in the knockout cell lines. Electroporation was performed on one million

cells in 100 μL PBS with 2 μg _PiggyBac_ vector containing the transgenes for _SRGAP2_ and puromycin resistance or luciferase and puromycin resistance and 2 μg CMV-PB7 _PiggyBac_

transposase. Following two days of incubation, cells were treated with 2 μg puromycin/mL of media to obtain a polyclonal population with an integrated transgene. _SRGAP2_ cDNA expression was

induced through the addition of 2.5 μg doxycycline/mL of media 48 hours prior to the initiation of experiments. ANALYSIS OF KNOCKOUT CLONES A 350 base pair region spanning the CRISPR gRNA

target sequence was PCR amplified and sequenced to assess for genomic mutations (for: ggccctgctgagttttgtta, rev: atcaatcttgccttccaagc). No commercial antibodies were found to bind murine

Srgap2 for Western blot analysis. Quantitative RT-PCR (qPCR) was, therefore, used to assess knockout of _Srgap2_ in K12 and K7M2 cell lines. Finally, to test for heterogeneity among the

different copies of the gene within cells, the TOPO TA Cloning Kit for Sequencing (Thermo Fisher) was used to sequence individual copies of _Srgap2_. PCR products from each cell line were

inserted into the TOPO vectors, and nine to ten colonies of competent bacteria for each knockout cell line were selected for sequencing. QUANTITATIVE RT-PCR RNA was extracted from cell lines

using the High Pure RNA Isolation Kit (Roche, Basel). 1 μg of extracted RNA was reverse transcribed into cDNA using the Transcriptor First Strand Synthesis kit (Roche). Quantitative RT-PCR

was performed in triplicate using SYBR green mix (Qiagen, Hilden) on an ABI 7500 machine (Applied Bio Systems, Foster City). Data was analyzed using Microsoft Excel and graphed using the

Prism software package. The following primer sequences were used: _SRGAP2_ (for: aggaggaagcatggaggatt, rev: ttcatcatcgcttgtgtggt), _Gapdh_ (for: gtgttcctacccccaatgtgt, rev:

gagacaacctggtcctcagtgt). Data was graphed and analyzed using the Prism software package. Two-tailed, unpaired t-tests were used to determine statistical significance (p < 0.05). WESTERN

BLOT ANALYSIS Protein was extracted from cultured cells in a NP-40 buffer (50 nM Tris HCL pH 7.6, 150 mM NaCl, 1% NP-40, 5 mM NaF, 1 m MEDTA; Thermo Fisher) containing a protease inhibitor

(Roche) and phosphatase inhibitors (Sigma-Aldrich, St. Louis). Protein samples were run on 10% Bis-Tris gels (NuPage, Thermo Fisher) and transferred to PVDF membranes. The membranes were

blocked in 5% nonfat dry milk for 1 hour and then incubated with primary antibody for 3 hours: SRGAP2 (1:1000, Abcam, Cambridge, #ab121977) and β-actin (1:2000, Abcam, #ab8227-50).

Subsequently, membranes were incubated in goat anti-rabbit IgG-HRP conjugated secondary antibody (1:5000, Santa Cruz, Dallas, #sc-2004) for one hour. Blots were thoroughly washed and

developed using the WesternBright Quantum detection kit (Advansta, Melano Park) and Licor Odyssey Image Studio. MTS PROLIFERATION ASSAY Two thousand cells were plated into 6 wells of a

96-well plate for each cell line, with three replicates per line, for a total of 18 wells. Cells were incubated for 24, 48, 72, and 96 hours, at which time 20 μL of a 1:20 mixture of

phenazine methosulfate (PMS): 3-(4,5-dimethylthiazol-2-yl)-5(3-carboxymethonyphenol)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) was added to each well. Cells were incubated for 4 hours and then

absorbance at 490 nm and 650 nm was read using the BioTek SynergyMx fluorescence plate reader. Normalized absorbance was obtained by subtracting the reading at 650 nm from the reading at 490

 nm and further subtracting the average reading of 6 media control wells. Data was graphed using the Prism software package. Due to multiple time points for each cell line, one-way analysis

of variance (ANOVA) was conducted at each time point (24 hours, 48 hours, 72 hours, and 96 hours). Significance was set at p < 0.01 Unpaired student t-tests were used to compare specific

time points (p < 0.05). Fold change for each time point was also calculated compared to 24 hours to evaluate changes in proliferation rates. WOUND HEALING ASSAY Cells were incubated for

24 hours in silicone inserts with two wells separated by a width of 500 μm +/− 50 μm (ibidi, Martinsried) in 35 mm dishes. Cell seeding was determined by plating 25, 30, 35, 40, 45, and 50 ×

 103 cells in insert wells. The lowest number of cells for which all transformed cell lines from each set were confluent at 24 hours was used for experiments: K12 (35,000), K7M2 (50,000).

Doxycycline was added to cells 24 hours prior to placement in inserts; cells were exposed to doxycycline for 48 hours prior to imaging. After inserts were removed, cells were rinsed with

PBS, and media with or without doxycycline was added to the dishes. For time lapse imaging, cell culture dishes were placed in a Bold Line top stage incubator (Okolab, Pozzuoli) at 37 °C and

5% CO2. Phase contrast images of the wounds were acquired every 15 minutes for 15 hours using a Nikon 10X (0.25NA Ph1 ADL) objective and a Nikon TiE stand with a Zyla 5.5 sCMOS camera

(Andor Technology, Belfast). Large image function on NIS element and Nikon Perfect Focus system were used to acquire large images of the entire wound. A custom-written image segmentation

algorithm in MATLAB was used to measure wound closure rate. Cell edges were identified using the Canny edge detection algorithm in MATLAB. The identified edges were then dilated to bridge

any gaps in the edge detection. Regions enclosed by the edge detection were filled and eroded back to their original size (Supplementary Fig. S2). Total unmasked area (gap area) was then

measured and divided by the image length to calculate the gap width for each frame. Finally, the wound closure rate was determined by calculating the slope of the linear segment of a gap

width vs. time curve (Supplementary Fig. S2). A minimum of 16 inserts was analyzed for each condition. Results were graphed using the Prism soft ware package, and statistical significance

was determined with unpaired student t-tests (p < 0.05). ANCHORAGE-INDEPENDENT GROWTH ASSAY A layer of sea plaque agar (Lonza, Basel) at a concentration of 0.8% in culture media was

placed into 6-well plates and allowed to solidify. A top layer was then placed into each well containing 10,000 cells in 0.48% agar in culture media and allowed to solidify. One mL of

culture media was placed on top of the solidified agar with or without 2.5 μg doxycycline/mL of media. Plates were incubated for 2 weeks, with one mL of culture media added to every well

after one week. After two weeks, the media was removed and cells were fixed in 10% buffered formalin (Thermo Fisher) containing 0.5% crystal violet for 2 hours. Each well was divided into

four quadrants and photographed on a Leica S8 AP0 microscope. Colonies were quantified using ImageJ software and graphed using the Prism software package. Three wells were used for each

condition, conducted in triplicate, giving 9 wells per condition and 36 quadrants for imaging. Two-tailed, unpaired t-tests with α = 0.05 were used to identify statistically significant

differences in colony numbers (p < 0.05). IMMUNOHISTOCHEMISTRY Tissue microarrays were purchased from Biomax (Normal bone: BO244d, Osteosarcoma: OS804a). Slides containing 4 μm thick

formalin-fixed, paraffin-embedded sections of tumor/control bone tissue were deparaffinized and rehydrated. Antigen retrieval was performed in a steamer using 1 mM Tris base EDTA buffer, pH

9.0. After endogenous peroxidase blocking, a protein block was applied. Immunohistochemistry (IHC) for SRGAP2 was performed using rabbit anti-SRGAP2 (Sigma-Aldrich HPA-028191) primary

antibody on a Dako Autostainer. Detection was achieved using the Dako Envision rabbit detection system with diaminobenzidine (Dako, Glostrup) as the chromogen. Sections were counterstained

with Mayer’s Hematoxylin (Dako). Xenograft tumors confirmed by western blot to express SRGAP2 were used as positive control. Tissue sections were imaged on a Nikon E800M microscope at 40X

magnification using a Nikon DSRi2 camera and Nikon Elements D Version 4 software. Each section was imaged using the same white balance and shading correction settings. Whole image sharpness

was uniformly adjusted with Photoshop Elements version 11 software. ADDITIONAL INFORMATION HOW TO CITE THIS ARTICLE: Marko, T. A. _et al_. Slit-Robo GTPase-Activating Protein 2 as a

metastasis suppressor in osteosarcoma. _Sci. Rep._ 6, 39059; doi: 10.1038/srep39059 (2016). PUBLISHER'S NOTE: Springer Nature remains neutral with regard to jurisdictional claims in

published maps and institutional affiliations. REFERENCES * Ries, L. G. et al. Cancer incidence and survival among children and adolescents: United States SEER Program 1975–1995. Cancer

incidence and survival among children and adolescents: United States SEER Program 1975–1995 (1999). * Mirabello, L., Troisi, R. J. & Savage, S. A. Osteosarcoma incidence and survival

rates from 1973 to 2004: data from the Surveillance, Epidemiology, and End Results Program. Cancer 115, 1531–1543 (2009). Article  Google Scholar  * Allison, D. C. et al. A meta-analysis of

osteosarcoma outcomes in the modern medical era. Sarcoma 2012, 704872 (2012). Article  Google Scholar  * Gorlick, R. & Khanna, C. Osteosarcoma. J. Bone Miner. Res. 25, 683–691 (2010).

Article  Google Scholar  * Savage, S. A. & Mirabello, L. Using epidemiology and genomics to understand osteosarcoma etiology. Sarcoma 2011, 548151 (2011). Article  Google Scholar  *

Stephens, P. J. et al. Massive genomic rearrangement acquired in a single catastrophic event during cancer development. Cell 144, 27–40 (2011). Article  CAS  MathSciNet  Google Scholar  *

Chen, X. et al. Recurrent somatic structural variations contribute to tumorigenesis in pediatric osteosarcoma. Cell reports 7, 104–112 (2014). Article  CAS  Google Scholar  * Moriarity, B.

S. et al. A Sleeping Beauty forward genetic screen identifies new genes and pathways driving osteosarcoma development and metastasis. Nat. Genet. (2015). * Guerrier, S. et al. The F-BAR

domain of srGAP2 induces membrane protrusions required for neuronal migration and morphogenesis. Cell 138, 990–1004 (2009). Article  CAS  Google Scholar  * Charrier, C. et al. Inhibition of

SRGAP2 function by its human-specific paralogs induces neoteny during spine maturation. Cell 149, 923–935 (2012). Article  CAS  Google Scholar  * Ma, Y. et al. The inverse F-BAR domain

protein srGAP2 acts through srGAP3 to modulate neuronal differentiation and neurite outgrowth of mouse neuroblastoma cells. PLoS One 8, e57865 (2013). Article  CAS  ADS  Google Scholar  *

Coutinho-Budd, J., Ghukasyan, V., Zylka, M. J. & Polleux, F. The F-BAR domains from srGAP1, srGAP2 and srGAP3 regulate membrane deformation differently. J. Cell. Sci. 125, 3390–3401

(2012). Article  CAS  Google Scholar  * Wong, K. et al. Signal transduction in neuronal migration: roles of GTPase activating proteins and the small GTPase Cdc42 in the Slit-Robo pathway.

Cell 107, 209–221 (2001). Article  CAS  Google Scholar  * Mason, F. M., Heimsath, E. G., Higgs, H. N. & Soderling, S. H. Bi-modal regulation of a formin by srGAP2. J. Biol. Chem. 286,

6577–6586 (2011). Article  CAS  Google Scholar  * Dennis, M. Y. et al. Evolution of human-specific neural SRGAP2 genes by incomplete segmental duplication. Cell 149, 912–922 (2012). Article

  CAS  Google Scholar  * Guo, S. & Bao, S. srGAP2 arginine methylation regulates cell migration and cell spreading through promoting dimerization. J. Biol. Chem. 285, 35133–35141 (2010).

Article  CAS  Google Scholar  * Abbott, K. L. et al. The Candidate Cancer Gene Database: a database of cancer driver genes from forward genetic screens in mice. Nucleic Acids Res. 43,

D844–8 (2015). Article  CAS  Google Scholar  * Rahrmann, E. P. et al. Forward genetic screen for malignant peripheral nerve sheath tumor formation identifies new genes and pathways driving

tumorigenesis. Nat. Genet. 45, 756–766 (2013). Article  CAS  Google Scholar  * Giotopoulos, G. et al. A novel mouse model identifies cooperating mutations and therapeutic targets critical

for chronic myeloid leukemia progression. J. Exp. Med. 212, 1551–1569 (2015). Article  CAS  Google Scholar  * Genovesi, L. A. et al. Sleeping Beauty mutagenesis in a mouse medulloblastoma

model defines networks that discriminate between human molecular subgroups. Proc. Natl. Acad. Sci. USA 110, E4325–34 (2013). Article  CAS  Google Scholar  * Temiz, N. A. et al. RNA

sequencing of Sleeping Beauty transposon-induced tumors detects transposon-RNA fusions in forward genetic cancer screens. Genome Res. 26, 119–129 (2016). Article  CAS  Google Scholar  *

Uluçkan, Ö., Segaliny, A., Botter, S., Santiago, J. M. & Mutsaers, A. J. Preclinical mouse models of osteosarcoma. BoneKEy reports 4 (2015). * Fritz, R. D. et al. SrGAP2-dependent

integration of membrane geometry and slit-robo-repulsive cues regulates fibroblast contact inhibition of locomotion. Developmental cell 35, 78–92 (2015). Article  CAS  Google Scholar  *

Zheng, Z. et al. miR-142 acts as a tumor suppressor in osteosarcoma cell lines by targeting Rac1. Oncol. Rep. 33, 1291–1299 (2015). Article  CAS  Google Scholar  * Guan, K. & Rao, Y.

Signalling mechanisms mediating neuronal responses to guidance cues. Nature Reviews Neuroscience 4, 941–956 (2003). Article  CAS  Google Scholar  * Bashaw, G. J., Kidd, T., Murray, D.,

Pawson, T. & Goodman, C. S. Repulsive axon guidance: Abelson and Enabled play opposing roles downstream of the roundabout receptor. Cell 101, 703–715 (2000). Article  CAS  Google Scholar

  * Bear, J. E. et al. Negative regulation of fibroblast motility by Ena/VASP proteins. Cell 101, 717–728 (2000). Article  CAS  Google Scholar  * Robinson, J. T. et al. Integrative genomics

viewer. Nat. Biotechnol. 29, 24–26 (2011). Article  CAS  Google Scholar  * Thorvaldsdottir, H., Robinson, J. T. & Mesirov, J. P. Integrative Genomics Viewer (IGV): high-performance

genomics data visualization and exploration. Brief Bioinform 14, 178–192 (2013). Article  CAS  Google Scholar  * Moriarity, B. S. et al. Simple and efficient methods for enrichment and

isolation of endonuclease modified cells. PloS one 9, e96114 (2014). Article  ADS  Google Scholar  Download references ACKNOWLEDGEMENTS This work was supported by NIH MSTP grant T32 GM008244

(TAM), NIH R01-CA113636 (DAL), NIH R01-CA172986 (DJO), ACS Research Professorship #123939 (DAL), and the Zach Sobiech Osteosarcoma Fund of the Children’s Cancer Research Fund, Minneapolis,

MN. AUTHOR INFORMATION AUTHORS AND AFFILIATIONS * University of Minnesota, Masonic Cancer Center Minneapolis, MN, USA Tracy A. Marko, Elizabeth N. Edwards, Paige E. Hazelton, Susan K. Rathe,

 Ingrid Cornax, Paula R. Overn, Jyotika Varshney, Branden S. Moriarity, M. Gerard O’Sullivan & David A. Largaespada * Department of Biomedical Engineering University of Minnesota,

Minneapolis, MN, USA Ghaidan A. Shamsan & David J. Odde * Comparative Pathology Shared Resource, University of Minnesota, Minneapolis, MN, USA Ingrid Cornax, Paula R. Overn & M.

Gerard O’Sullivan * Department of Pediatrics, University of Minnesota, Minneapolis, MN, USA Brandon J. Diessner, Branden S. Moriarity & David A. Largaespada * Center for Genome

Engineering, University of Minnesota, Minneapolis, MN, USA Branden S. Moriarity * Department of Veterinary Population Medicine, College of Veterinary Medicine, University of Minnesota,

Minneapolis, MN, USA M. Gerard O’Sullivan Authors * Tracy A. Marko View author publications You can also search for this author inPubMed Google Scholar * Ghaidan A. Shamsan View author

publications You can also search for this author inPubMed Google Scholar * Elizabeth N. Edwards View author publications You can also search for this author inPubMed Google Scholar * Paige

E. Hazelton View author publications You can also search for this author inPubMed Google Scholar * Susan K. Rathe View author publications You can also search for this author inPubMed Google

Scholar * Ingrid Cornax View author publications You can also search for this author inPubMed Google Scholar * Paula R. Overn View author publications You can also search for this author

inPubMed Google Scholar * Jyotika Varshney View author publications You can also search for this author inPubMed Google Scholar * Brandon J. Diessner View author publications You can also

search for this author inPubMed Google Scholar * Branden S. Moriarity View author publications You can also search for this author inPubMed Google Scholar * M. Gerard O’Sullivan View author

publications You can also search for this author inPubMed Google Scholar * David J. Odde View author publications You can also search for this author inPubMed Google Scholar * David A.

Largaespada View author publications You can also search for this author inPubMed Google Scholar CONTRIBUTIONS All authors reviewed the manuscript. T.A.M.: Wrote the manuscript and prepared

Figures 1–5, Supplementary Figure S1, and Supplementary Table S1. Performed transposon integration analysis, Western blotting, wound healing assays, MTS proliferation assays, and

anchorage-independent growth assays. Supervised the creation of cell-lines and their expression analysis. G.A.S.: Assisted in performing wound healing assays and analyzed all wound healing

data. Prepared Supplementary Figure S2. Contributed to writing relevant methods section. E.N.E.: Created overexpression cell lines and assisted in cell line maintenance. Imaged and analyzed

all anchorage independent growth data. P.E.H.: Generated knockout cell lines and performed sequencing around gRNA target sequence. Assisted in cell line maintenance. S.K.R.: Analyzed RNA

sequencing data from _Sleeping Beauty_ derived primary tumors and human tissue samples. Prepared Figure 6 and Supplementary Tables S2, S5, and S6. Contributed to writing relevant methods

section. I.C.: Analyzed TMA immunohistochemistry staining, prepared summary report (Supplementary Table S4), and created images included in Figure 5. Contributed to writing relevant methods

section. P.R.O.: Performed H&E and immunohistochemistry staining on TMA. Contributed to writing relevant methods section. J.V.: Performed quantitative RT-PCR. B.J.D.: Performed ANOVA

analysis on proliferation data and prepared Supplementary Table S3. B.S.M.: Provided vectors and guidance for cell line creation and expression analysis. M.G.S.: Supervised the analysis and

interpretation of TMA immunohistochemistry staining. D.J.O.: Supervised the collection, analysis, and interpretation of wound healing data. D.A.L.: Assisted in experimental design, data

analysis, and data interpretation. Supervised all work and is the corresponding author. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare no competing financial interests.

ELECTRONIC SUPPLEMENTARY MATERIAL SUPPLEMENTARY INFORMATION RIGHTS AND PERMISSIONS This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other

third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative

Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

Reprints and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Marko, T., Shamsan, G., Edwards, E. _et al._ Slit-Robo GTPase-Activating Protein 2 as a metastasis suppressor in osteosarcoma.

_Sci Rep_ 6, 39059 (2016). https://doi.org/10.1038/srep39059 Download citation * Received: 23 August 2016 * Accepted: 16 November 2016 * Published: 14 December 2016 * DOI:

https://doi.org/10.1038/srep39059 SHARE THIS ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link Sorry, a shareable link is not currently

available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative