Bhx inhibits the wnt signaling pathway by suppressing β-catenin transcription in the nucleus

ABSTRACT BHX (N-(4-hydroxybenzyl)-1,3,4-triphenyl-4,5-dihydro-1H-pyrazole-5-carboxamide), a Wnt signaling pathway inhibitor, effectively inhibits tumor cell growth, but the underlying

mechanism is unclear. Thus, we aim to investigate the effects and associated mechanism of BHX action on A549 and MCF-7 cell lines. In our study,

MTT(3-[4,5-dimethyl-2-thiazolyl]-2,5-diphenyl-2H-tetrazolium bromide) and xenograft model assay indicated that cell growth was inhibited by BHX at a range of concentrations _in vitro_ and

_in vivo_. The expression of β-catenin and Wnt signaling pathway downstream target genes were decreased evidently under BHX treatment. Flow cytometry also revealed that BHX treatment

significantly induced G1 arrest. Further analysis showed that BHX lowered the transcriptional level of β-catenin. In conclusion, BHX inhibited the nuclear synthesis of β-catenin, thereby

suppressing the Wnt signaling pathway and further inhibiting tumor growth and proliferation. SIMILAR CONTENT BEING VIEWED BY OTHERS BIX01294 INHIBITS EGFR SIGNALING IN EGFR-MUTANT LUNG

ADENOCARCINOMA CELLS THROUGH A BCKDHA-MEDIATED REDUCTION IN THE EGFR LEVEL Article Open access 07 December 2021 RTKN2 KNOCKDOWN ALLEVIATES THE MALIGNANCY OF BREAST CANCER CELLS BY REGULATING

THE WNT/Β-CATENIN PATHWAY Article Open access 27 December 2023 DEOXYBOUVARDIN TARGETS EGFR, MET, AND AKT SIGNALING TO SUPPRESS NON-SMALL CELL LUNG CANCER CELLS Article Open access 06

September 2024 INTRODUCTION Cancer is a condition that results from the joint involvement of multiple genes, factors, and stages. Cellular signal transduction pathways play a vital role in

tumor development and occurrence1. The Wnt signaling pathway is highly involved in cell proliferation, migration, apoptosis, and fate determination during early embryonic growth and

development2,3. At present, the Wnt/β-catenin signaling pathway is an intensively studied signal transduction pathway, which is also highly conserved throughout evolution4,5. Aberrant

Wnt/β-catenin pathway activation is strongly linked to the development of many cancers6,7. When the canonical Wnt signaling pathway is activated abnormally, the Axin/GSK-3/APC complex cannot

phosphorylate β-catenin, leading to the latter’s ubiquitination and subsequent degradation. Non-phosphorylated β-catenin accumulates in the cytoplasm, so that cytoplasmic β-catenin is

stabilized and transported further into the nucleus and interacts with TCF/LEF3,8. Subsequently, the Wnt pathway downstream target genes are involved in cell fate and proliferation

regulation. These target genes include c-myc, cyclin D1, c-Jun, c-fos, and some members of the Fra-1 and AP-1 family9,10. Wnt signaling pathway includes a variety of proteins, abnormal

transcription and expression of signaling molecules are the main reason that activate Wnt signaling pathway11,12. Therefore, various specific targeted drugs have been developed. Inhibitors

that disrupt the β-catenin and TCF interaction have been widely explored, as well as RNAi approaches, ICG-001, PKF115–58413,14. There are also some inhibitors targeting Frizzled such as

OMP-18R5 and 3289–862515. However, toxicity, side effects and other shortcomings appear. In spite of these potential hurdles, research toward identifying potent Wnt pathway antagonists for

cancer treatment is promising. On the basis of previous studies, we generated a computer-aided design of small-molecule inhibitors and synthesized the novel pyrazoline derivative BHX

(N-(4-hydroxybenzyl)-1,3,4-triphenyl-4,5-dihydro-1H-pyrazole-5-carboxamide) to block Wnt signaling16. We discovered that BHX could inhibit the growth of cancer cell, but the mechanism was

unclear. In this study, we evaluated the anti-cancer effect of BHX on lung and breast cancers and then discovered the mechanisms of the underlying effects. Our results provide a rationale

for the further development of BHX as a prospective therapeutic agent for cancer that involves Wnt pathway activation. RESULTS BHX INHIBITS THE PROLIFERATION OF CANCER CELL _IN VITRO_ AND

_IN VIVO_ To explore the tumor inhibitory effect of BHX _in vitro_ and _in vivo_,We first examined the cytotoxicity of BHX in human lung cancer cell lines and normal lung epithelial cells

(Beas-2b). BHX(molecular structure were shown in Fig. 1a) displayed moderate cytotoxicity to the Beas-2b cells with an IC50 of 28.08 μM by MTT assay. However, the IC50 of the A549 cells was

15.49 μM (Fig. 1b), which was significantly lower than that of the Beas-2b (Fig. 1c). We selected another Wnt-pathway-activated cell, i.e., the breast cancer cell line MCF-7. BHX inhibited

tumor cell proliferation in a dose-dependent manner by the MTT assay (Fig. 1d). BHX also suppressed the clonogenic activity of these two cell lines (Fig. 1e). Then, we used BALB/c nude mice,

which were implanted with A549 cells by subcutaneous injection, for testing against cisplatin as positive control17, In the cisplatin group, the growth of the implanted tumors was

significantly inhibited, but the weight of the cisplatin group decreased rapidly, and two nude mice died. However, the weights of the nude mice in the control and BHX groups did not change

(Fig. 1f). At the same time, BHX inhibited tumor growth significantly. The tumor growth inhibition of the high-dose group was stronger than that of the low-dose group but lower than that of

the cisplatin group (Fig. 1g). Although cisplatin showed a strong tumor inhibitory effect in the A549 tumor-bearing mice, the drug exhibited substantial toxicity, unlike BHX, which showed

almost no toxicity. All the results proved that BHX effectively inhibited human tumor cell proliferation. Moreover, BHX showed lower toxicity effect _in vitro_ and _in vivo_. BHX REDUCES

ENDOGENOUS Β-CATENIN AND DECREASES ITS TRANSLOCATION INTO THE NUCLEUS To determine whether the tumor cell growth inhibitor effect of BHX in breast and lung cancer cells is mediated by the

regulation of the Wnt/β-catenin signaling components, we carried out Western blot assay. The expression of the β-catenin protein was also diminished significantly following the 72 h BHX

treatment. After BHX treatment, the expression levels of β-catenin in the nucleus were decreased (Fig. 2a). We also examined the expression levels of total β-catenin in A549 and MCF-7 cells

by Western blot. Findings clearly showed that the expression of total β-catenin also decreased compared with the control (Fig. 2b). The nuclear translocation of β-catenin is a crucial factor

in the activation of the Wnt/β-catenin signaling pathway. Then we checked the effect of BHX on the location of nuclear β-catenin by immunofluorescence assay. Results revealed that β-catenin

levels were decreased in the cell nucleus (Fig. 3a,b). BHX REGULATES THE CELL CYCLE BY CONTROLLING THE WNT SIGNALING PATHWAY When the Wnt signaling pathway is activated, β-catenin interacts

with the TCF and lymphoid enhancer–binding factor (LEF) in the nucleus. This interaction activates downstream target genes transcription, including those of c-Myc and cyclin D1, which are

involved in the regulation of cell proliferation and cell cycle18,19. To further confirm the effect of BHX on the Wnt signaling pathway, we analyzed the Wnt pathway downstream target genes

c-myc and cyclin D1 by Western blot. Cyclin D1 is essential for the G1/S transition in the cell cycle. Western blot analysis showed that the BHX treatment markedly reduced the expression of

cyclin D1 and c-myc in the tumor cells (Fig. 4a,b). Then we estimated the effect of BHX on the cell-cycle distribution. The A549 and MCF-7 cells which were treated with or without BHX were

subjected to flow cytometry analysis. Data showed that compared with the control samples, BHX induced a G1 phase increased by 30% and a slight decrease in S phase (Fig. 5a,b). The

above-mentioned data indicated that BHX arrested the cell cycle in the G0/G1 phase in a concentration-dependent manner. BHX PREVENTS THE TRANSCRIPTION OF Β-CATENIN, BUT IS NOT INVOLVED IN

GSK-3Β-DEPENDENT PHOSPHORYLATION OF Β-CATENIN Accumulated β-catenin travels to the nucleus and activates the Wnt signaling pathway. The results have already showed that the expression of

p-β-catenin did not increase which compared with the control but BHX slightly decreased the p-β-catenin expression (Fig. 6a). Therefore, we examined β-catenin at the transcriptional level by

PCR, and results revealed that the mRNA level of β-catenin was decreased remarkably at 20 μM (Fig. 6b). Hence, BHX reduced the expression of β-catenin not by blocking the Wnt signaling

pathway upstream but by reducing β-catenin mRNA levels, thereby reducing transcription and translation, and ultimately reducing protein expression. Thus, the total amount of β-catenin was

reduced, and p-β-catenin levels also was lowered slightly. DISCUSSION The Wnt signaling pathway plays an indispensable role in normal development and is also important in oncogenesis. The

malignant activation of the Wnt signaling pathway leads to the onset of multiple types of cancers20. Meanwhile, β-catenin is a key activator of the canonical Wnt signaling pathway21. The

abnormal accumulation and nuclear translocation of β-catenin play an important role in all of the β-catenin mutations22. Therefore, restraining the expression of β-catenin and nuclear

translocation can be a potential therapeutic strategy23. In our study, BHX decreased the protein levels of β-catenin and the downstream target genes cyclinD1 and c-myc. BHX inhibited

β-catenin expression by decreasing the molecule’s transcription. The PCR analysis showed that BHX induced a dose-dependent inhibitory effect on the β-catenin mRNA levels. BHX effectively

inhibited tumor cell proliferation _in vitro_ and _in vivo_. The antitumor effects exerted a close relationship with the inhibition of the Wnt signaling pathway. Thus, we examined the Wnt

signaling key factor β-catenin protein in the nucleus after being treated with BHX. In fact, the effects of BHX on the β-catenin protein expression levels were analyzed by immunofluorescence

and Western blot, revealing that BHX decreased β-catenin levels in the cell nucleus. Down-regulating the nuclear β-catenin reduces the interaction of β-catenin and TCF/LEF, thereby

suppressing the Wnt signaling pathway24. Herein, we also showed that the suppression of the nuclear translocation of β-catenin resulted in the down-regulated expression of cyclin D1 and

c-myc, which were downstream oncogenes of the Wnt/β-catenin signaling pathway25,26. Cyclin D1 participates in the phase transitions of the cell cycle by phosphorylating the retinoblastoma

protein. Cell-cycle regulation is pivotal in the control of cell proliferation and closely related to the Wnt signaling pathway27. After being treated with BHX, tumor cells were arrested in

the G1 phase. Moreover, BHX induced cell-cycle arrest in a concentration-dependent manner. As the indispensable mediator of the Wnt/β-catenin signaling pathway, β-catenin functions as a

localization protein28. Membrane-localized β-catenin is isolated by the E-cadherin to maintain cell–cell adhesion. In addition, the classical Wnt signaling pathway causes the accumulation of

β-catenin, and access to nucleus regulates target gene expression. In the absence of Wnt signaling, the level of β-catenin remained low through the degradation of cytoplasmic β-catenin,

which is targeted for phosphorylation by CK1-α at the Ser45 site, followed by phosphorylation by GSK3-β at Ser33, Ser37, and Thr4129,30. This process then leads to ubiquitination. Thus, we

detected β-catenin phosphorylation levels at the Ser45/Thr41 site in the cells treated with BHX. Interestingly, the phosphorylation levels were not elevated but also slightly lower than the

control. Subsequently, we found that β-catenin mRNA levels decreased, implying that the synthesis of β-catenin was reduced. Consequently, β-catenin transcription and translation was

down-regulated, decreasing β-catenin levels in the cytoplasm, and ultimately inhibiting the Wnt signaling pathway. Meanwhile, the Wnt signaling pathway is known to undergo crosstalk with

other signaling pathways, such as the TGF-β, Notch, and MAPK signaling pathways31,32, which play important roles in the development of tumor cells. Thus, other mechanisms may be involved in

the antitumor effect of BHX. In conclusion, our findings provide evidence that BHX may inhibit tumor cell proliferation by attenuating the Wnt/β-catenin signaling pathway through nuclear

β-catenin level reduction. Such mechanism was found to be accompanied by the down-regulation of cyclin D1 and c-myc, which is tightly connected to the development and prognosis of tumor

cells. The mechanism probably involves the decrease in β-catenin transcription and translation. Cisplatin and any other first-line chemotherapy drug hold the disadvantage of strong toxicity

and side effects; non-specificity of drug action is a reason for this phenomenon, thus limiting clinical application33. By contrast, the small-molecule inhibitor BHX targets tumor cells

activated by the Wnt signaling pathway but only affects normal cells activated by the same pathway to a lower extent. Thus, BHX holds the potential to be developed to a safe therapeutic drug

for Wnt-activated tumors. MATERIALS AND METHODS CELL LINES AND CULTURE CONDITIONS Human tumor cell lines A549 (lung adenocarcinoma cell line) and MCF-7 (the breast cancer cell line) were

acquired from the American Type Tissue Cell Culture Collection, whereas Beas-2b cells were frozen and stored in our laboratory. The A549 cells were cultured in RPMI 1640 (Gibco), and the

MCF-7 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, Gibco) supplemented with 10% fetal bovine serum (Gibco), 1% penicillin (100 IU/mL), and streptomycin (100 mg/mL) at

37 °C in an incubator under 5% CO2. The Beas-2b cells were cultured using LHC-8 medium (Gibco). DRUG BHX was dissolved in dimethyl sulfoxide (DMSO) at a final concentration of 40 mM, stored

as a stock solution at −20 °C, and diluted in DMEM before using. CELL VIABILITY ASSAY The effect of BHX on cellular proliferation and viability was determined by MTT assay (R&D Systems,

UK). The A549, MCF-7, and Beas-2b cells were seeded in 96-well plates at a density of 3.0 × 103 cells/well in 100 μL of medium and allowed to attach overnight. The cells were then treated

with BHX at increasing concentrations (0–80 μM) for 24, 48, and 72 h. Subsequently, the cells were incubated with the MTT reagent at a final concentration of 5 mg/ml for 4 h. Finally, the

intracellular formazan crystals were solubilized with 150 μl DMSO. Absorbance was measured at 490 nm using an enzyme-linked immunosorbent assay plate reader, and the reduction in cell

viability in different treatment groups was expressed as the percentage compared with BHX-treated and BHX-free control cells. All experiments were performed in triplicate. COLONY-FORMING

ASSAY Colony-forming assay was performed to evaluate the long-term drug efficiency. A549 and MCF-7 cells were seeded at 200 cells/well into 12-well plates with 1 ml DMEM and allowed to

attach overnight. The cells were exposed to increasing concentrations (0–20 μM) of BHX for 72 h, followed by medium removal and incubation in fresh medium for 2 weeks at 37 °C. The cells

were then fixed with 100% ethanol (4 °C, 20 min) and stained with 1% crystal violet (Sigma) for 15 min. Colonies that contained more than 50 cells were counted. Clonogenic capability was

calculated as the ratio between treated counted clones and the corresponding number of clones control well. Each experiment was performed in triplicate. CELL-CYCLE ANALYSIS Cell-cycle

distribution was performed as described previously34. Briefly, cells were treated with BHX (0–20 μM) for 48 h. After treatment, attached cells were trypsinized, and then harvested and washed

with PBS. Cells were centrifuged (1000 rpm, 5 min) and subsequently fixed with ice-cold 70% ethanol for 24 h. After centrifugation, cells were washed twice and then re-suspended in PBS

containing propidium iodide (40 μg/ml), RNase A (100 μg/ml), and Triton X-100 (0.05%) and incubated at 37 °C for 15 min. Cell cycle was analyzed using a FACS flow cytometer. WESTERN BLOT

ANALYSIS To determine the change of protein expression level, Western blot analysis was performed. Protein of the treated cells lysates was prepared by Bradford assay. Protein concentration

was determined using Pierce BCA protein assay kit (Thermo Scientific). Equivalent amounts (50 μg protein/lane) of protein lysates were separated by 8% sodium dodecyl sulfate–polyacrylamide

gel electrophoresis and transferred onto polyvinylidene membranes in a transfer tank (Bio-Rad Laboratories) using the submerged method. Membranes were blocked for 1 h at room temperature in

5% (w/v) fat-free milk powder in 1× TBS containing 1% Tween 20 and then incubated with the primary antibody (1:1000 dilution) with gentle agitation overnight at 4 °C. The primary antibodies

were as follows: anti-β-catenin (1:1000 dilution, rabbit monoclonal antibody, Cell Signaling Technology), anti-β-actin (1:1000 dilution, mouse monoclonal antibody, Cell Signaling

Technology), anti-cyclin D1 and anti-c-myc (1:1000 dilution, rabbit monoclonal antibody, Cell Signaling Technology), anti-Lamin B (1:1000 dilution, rabbit monoclonal antibody, Santa Cruz

Biotechnology, Santa Cruz, CA), and anti-p-β-catenin (Ser45/Thr41, 1:200 dilution, rabbit monoclonal antibody, Santa Cruz Biotechnology, Santa Cruz, CA). Then, the membranes were washed

three times with 0.1% Tween 20 in Tris HCL buffer and incubated with secondary goat anti-mouse-horseradish peroxidase (HRP) and goat anti-rabbit HRP antibodies (Bio-Rad) were used at 1:5000

for 1 h at room temperature. After final washing with 0.1% Tween 20 in TBS (three times for 10 min each), blots were developed using a luminescent image analyzer LAS-4000 (Fujifilm,

Dielsdorf, Switzerland) and Multi Gauge software (Fujifilm Version 3.0). PCR ANALYSIS A549 and MCF-7 cells were plated on a 6 cm dish at a density of 2 × 105 per dish; each dish contained 3 

ml medium, and the cells were allowed to attach overnight. The cells were then exposed to increasing concentrations (0–20 μM) of BHX for 72 h. Total RNA was extracted using TRIzol reagent

(Life Technologies, USA) in accordance with the manufacturer’s instructions. Isolated RNA samples were quantified by a NanoDrop 3300 spectrophotometer (Thermo Scientific, NanoDrop Products,

Wilmington, DE, USA). The isolated RNA (5 μg) was used to prepare complementary DNA using a RevertAid First Strand cDNA Synthesis Kit following manufacturer’s protocols (Thermo Scientific,

USA). β-Catenin was amplified by a standard PCR protocol using 5′–ACAACTGTTTTGAAAATCCA–3′ as forward primer, 5′–CGAGTCATTGCATACTGTCC–3′ as reverse primer, and the prepared cDNA as a

template. The internal control GAPDH adopted 5′–ACCACAGTCCATGCCATCAC–3′ as forward primer and 5′–TCCACCACCCTGTTGCTGTA–3′ as reverse primer. The reaction mixtures were heated at 95 °C for 10 

min, followed by 30 cycles of 94 °C for 30 s, 58 °C for 30 s, 72 °C for 20 s, and a final extension at 72 °C for 5 min. Subsequently, PCR products were electrophoresed through 1.5% agarose

gel and then subjected to a gel/fluorescence image analysis system for scanning. IMMUNOFLUORESCENCE For immunofluorescence studies, A549 and MCF-7 cells were plated on glass cover slips

placed on 12-well plates. Cells were exposed to increasing concentrations (0–20 μM) of BHX for 72 h. Before staining, the cells were fixed with 4% paraformaldehyde (Sigma) for 10 min,

permeabilized in 0.1% Triton X-100 for 15 min, and blocked in 3% BSA at room temperature for 1 h. Each previous step was accompanied by PBS wash twice. Cells were incubated with mouse

monoclonal antibodies to β-catenin (1:200) overnight at 4 °C in a humid chamber and then incubated with goat anti-mouse Alexa-647 antibody (1:150) for 1 h at room temperature. Both primary

and secondary antibodies were diluted in PBS. Representative images were captured by a Zeiss LSM510 Meta-confocal microscope. TUMOR XENOGRAFT Antitumor activity studies were performed on

8-week-old female BALB/c mice weighing about 20 g. Briefly, an A549 cell (2 × 107/ml) suspension was injected into the right groin (150 μl growth medium) of each mouse. Tumor volume was

calculated by the formula V = (_a_ × _b_2)/235, in which a is the length and b is the width. When the tumor volumes reached about 100 mm3 to 150 mm3, the mice were randomly divided into four

groups, including BHX-treated, vehicle, and cisplatin-treated (six mice per group). The BHX-treated group received intraperitoneal injection at increasing dose levels of 50 and 100 mg/kg

body weight for 3 weeks, consecutively. By contrast, the cisplatin-treated group received intraperitoneal injection at a dose of 4 mg/kg twice a week. Tumor volume was measured every 3 days,

and body weight was measured daily for safety evaluation. All experimental protocols were approved by Animal Care Committee of Tianjin Medical University Cancer Institute and Hospital,

China. And all the experiments were performed in accordance with relevant guidelines and regulations of Animal Care Committee of Tianjin Medical University Cancer Institute and Hospital.

STATISTICAL ANALYSIS Data were expressed as mean ± SD. Statistical analyses were performed using the SPSS version 16.0 software. Multiple groups comparison was analyzed by one-way analysis

of variance(ANOVA). Two group comparison was analyzed by unpaired two-tailed student’s t-test. A probability of P ≤ 0.05 was considered statistically significant. ADDITIONAL INFORMATION HOW

TO CITE THIS ARTICLE: Ding, F. _et al_. BHX Inhibits the Wnt Signaling Pathway by Suppressing β-catenin Transcription in the Nucleus. _Sci. Rep._ 6, 38331; doi: 10.1038/srep38331 (2016).

PUBLISHER’S NOTE: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations. REFERENCES * Guohong, H., Yong, W. & Yibin, K.

The multifaceted role of MTDH/AEG-1 in cancer progression. Clinical Cancer Research An Official Journal of the American Association for Cancer Research 15, 5615–5620 (2009). Article  CAS 

Google Scholar  * Ma, L. et al. Tankyrase inhibitors attenuate WNT/β-catenin signaling and inhibit growth of hepatocellular carcinoma cells. Oncotarget 93, 8291–8297 (2015). Google Scholar 

* Jacques, B. E. et al. The role of Wnt/β - catenin signaling in proliferation and regeneration of the developing basilar papilla and lateral line. Developmental neurobiology 74, 438–456

(2014). Article  CAS  PubMed  Google Scholar  * Bastin, B. R., Chou, H. C., Pruitt, M. M. & Schneider, S. Q. Structure, phylogeny, and expression of the frizzled-related gene family in

the lophotrochozoan annelid Platynereis dumerilii. Evodevo 6, 1–24 (2015). Article  CAS  Google Scholar  * Adamska, M. et al. Structure and expression of conserved Wnt pathway components in

the demosponge Amphimedon queenslandica. Evolution & Development 12, 494–518 (2010). Article  CAS  Google Scholar  * Huang, C. et al. Wnt2 promotes non-small cell lung cancer progression

by activating WNT/beta-catenin pathway. American Journal of Cancer Research 5, 1653–1662 (2015). Google Scholar  * Hwang, I., Seo, E.-Y. & Ha, H. Wnt/beta-catenin Signaling: A Novel

Target for Therapeutic Intervention of Fibrotic Kidney Disease. Archives of Pharmacal Research 32, 1653–1662, doi: 10.1007/s12272-009-2200-3 (2009). Article  CAS  PubMed  Google Scholar  *

Hsu, S. C., Galceran, J. & Grosschedl, R. Modulation of transcriptional regulation by LEF-1 in response to Wnt-1 signaling and association with beta-catenin. Molecular & Cellular

Biology 18, 4807–4818 (1998). Article  CAS  Google Scholar  * Li, J. et al. The expression and significance of dishevelled in human glioma. The Journal of surgical research 192, 509–514,

doi: 10.1016/j.jss.2014.06.034 (2014). Article  CAS  PubMed  Google Scholar  * Thévenod, F. & Chakraborty, P. K. The role of Wnt/beta-catenin signaling in renal carcinogenesis: lessons

from cadmium toxicity studies. Current Molecular Medicine 10, 387–404 (2010). Article  PubMed  Google Scholar  * Tai, D. et al. Targeting the WNT Signaling Pathway in Cancer Therapeutics.

The oncologist, doi: 10.1634/theoncologist.2015-0057 (2015). * Pez, F. et al. Wnt signaling and hepatocarcinogenesis: Molecular targets for the development of innovative anticancer drugs.

Journal of Hepatology 59, 1107–1117 (2013). Article  CAS  PubMed  Google Scholar  * Zhang, X. et al. Wnt blockers inhibit the proliferation of lung cancer stem cells. Drug design,

development and therapy 9, 2399–2407, doi: 10.2147/DDDT.S76602 (2015). Article  PubMed  PubMed Central  CAS  Google Scholar  * King, T. D., Wei, Z., Suto, M. J. & Li, Y. Frizzled7 as an

emerging target for cancer therapy. Cellular signalling 24, 846–851 (2012). Article  CAS  PubMed  Google Scholar  * Le, P. N., Mcdermott, J. D. & Jimeno, A. Targeting the Wnt pathway in

human cancers: Therapeutic targeting with a focus on OMP-54F28. Pharmacology & Therapeutics 146, 1–11 (2015). Article  CAS  Google Scholar  * Zhao, Y. et al. Synthesis, characterization,

and evaluation of a novel inhibitor of WNT/β-catenin signaling pathway. Molecular cancer 12, 2095–2101 (2013). Google Scholar  * Ming-Feng, C., Chih-Min, Y., Cheng-Ming, S., Jiunn-Wang, L.

& Miao-Lin, H. Inhibitory effect of vitamin C in combination with vitamin K3 on tumor growth and metastasis of Lewis lung carcinoma xenografted in C57BL/6 mice. Nutrition & Cancer

63, 1036–1043 (2011). Article  CAS  Google Scholar  * He, L. et al. Wogonin induced G1 cell cycle arrest by regulating Wnt/beta-catenin signaling pathway and inactivating CDK8 in human

colorectal cancer carcinoma cells. Toxicology 312, 36–47, doi: 10.1016/j.tox.2013.07.013 (2013). Article  CAS  PubMed  Google Scholar  * Cosimelli, B. et al. Synthesis and biological

evaluation of imidazo[1,2-a]pyrimidines and imidazo[1,2-a]pyridines as new inhibitors of the Wnt/β-catenin signaling. European Journal of Medicinal Chemistry 83, 45–56 (2014). Article  CAS 

PubMed  Google Scholar  * A., M. et al. The river blindness drug Ivermectin and related macrocyclic lactones inhibit WNT-TCF pathway responses in human cancer. Embo Molecular Medicine 6,

1263–1278 (2014). Article  CAS  Google Scholar  * Xiaojie, Y. et al. Nucleoporin 62-Like Protein Activates Canonical Wnt Signaling through Facilitating the Nuclear Import of β-Catenin in

Zebrafish. Molecular & Cellular Biology 35, 1110–1124 (2015). Article  CAS  Google Scholar  * He, M. et al. Curcumin suppresses cell proliferation through inhibition of the

Wnt/beta-catenin signaling pathway in medulloblastoma. Oncology reports 32, 173–180, doi: 10.3892/or.2014.3206 (2014). Article  CAS  PubMed  Google Scholar  * Evason, K. J. et al.

Identification of Chemical Inhibitors of β-Catenin-Driven Liver Tumorigenesis in Zebrafish. Plos Genetics 11, 3231–3238 (2015). Article  CAS  Google Scholar  * Barrott, J. J. et al.

beta-catenin stabilization enhances SS18-SSX2-driven synovial sarcomagenesis and blocks the mesenchymal to epithelial transition. Oncotarget 82, 932–940 (2015). Google Scholar  * Huidong, S.

et al. Overexpression of Klotho suppresses liver cancer progression and induces cell apoptosis by negatively regulating wnt/β-catenin signaling pathway. World Journal of Surgical Oncology

13, 1–8 (2015). Article  Google Scholar  * Almut, K. et al. Loss of Xenopus cadherin-11 leads to increased Wnt/β-catenin signaling and up-regulation of target genes c-myc and cyclin D1 in

neural crest. Developmental Biology 383, 132–145 (2013). Article  CAS  Google Scholar  * Li, X. et al. Henryin, an ent-kaurane Diterpenoid, Inhibits Wnt Signaling through Interference with

β-Catenin/TCF4 Interaction in Colorectal Cancer Cells. Plos one 8, 68525–68525 (2013). Article  ADS  CAS  Google Scholar  * Wong, S. C., Chan, A. T., Lo, E. S. & Lo, Y. M. Nuclear

beta-catenin expression is rare and its potential association with short survival in colorectal signet-ring cell carcinoma. Applied Immunohistochemistry & Molecular Morphology Aimm 13,

248–251 (2005). Article  CAS  Google Scholar  * Ohishi, K. et al. Coronaridine, an iboga type alkaloid from Tabernaemontana divaricata, inhibits the Wnt signaling pathway by decreasing

beta-catenin mRNA expression. Bioorganic & medicinal chemistry letters 25, 3937–3940, doi: 10.1016/j.bmcl.2015.07.036 (2015). Article  CAS  Google Scholar  * Geng, W., He, H., Jose, G.

A. & Xi, H. Inhibition of GSK3 phosphorylation of beta-catenin via phosphorylated PPPSPXS motifs of Wnt coreceptor LRP6. Plos one 4, 4926–4931 (2009). Article  ADS  CAS  Google Scholar 

* Rahman, M. S., Akhtar, N., Jamil, H. M., Banik, R. S. & Asaduzzaman, S. M. TGF-β/BMP signaling and other molecular events: regulation of osteoblastogenesis and bone formation. Virtual

Mentor Vm 15, 101–103 (2015). Google Scholar  * Hasson, P. et al. EGFR signaling attenuates Groucho-dependent repression to antagonize Notch transcriptional output. Nature Genetics 37,

101–105 (2005). Article  CAS  PubMed  Google Scholar  * Shimada, Y. et al. Survival of a surgical series of lung cancer patients with synchronous multiple ground-glass opacities, and the

management of their residual lesions. Lung Cancer 88, 174–180 (2015). Article  PubMed  Google Scholar  * Shirali, S. et al. Adenosine induces cell cycle arrest and apoptosis via

cyclinD1/Cdk4 and Bcl-2/Bax pathways in human ovarian cancer cell line OVCAR-3. Tumor Biology 34, 1085–1095 (2013). Article  CAS  PubMed  Google Scholar  * Zhou, J., Tang, Z. & Fan, J.

The expression of platelet-derived endothelial cell growth factor in liver cancer. National Medical Journal of China 80, 831–834 (2000). CAS  PubMed  Google Scholar  Download references

ACKNOWLEDGEMENTS This work was supported by the National Natural Science Foundation of China (No. 81402481), the Research Foundation of Tianjin Health Bureau (No. 2014KZ085) and the Research

Foundation of Tianjin Medical University Cancer Institute and Hospital fund (No. B1312). This work was also supported by the Science Foundation from Continuing Education and Technology

Services Department, Chinese Anti-cancer Association. AUTHOR INFORMATION Author notes * Ding Fengxia and Wang Meisa contributed equally to this work. AUTHORS AND AFFILIATIONS * Department of

Clinical Pharmacology, Tianjin Medical University Cancer Institute and Hospital, National Clinical Research Center for Cancer, Key Laboratory of Cancer Prevention and Therapy, Tianjin,

300060, P.R. China Fengxia Ding, Meisa Wang, Yibo Du, Shuangshuang Du, Zhongling Zhu & Zhao Yan Authors * Fengxia Ding View author publications You can also search for this author

inPubMed Google Scholar * Meisa Wang View author publications You can also search for this author inPubMed Google Scholar * Yibo Du View author publications You can also search for this

author inPubMed Google Scholar * Shuangshuang Du View author publications You can also search for this author inPubMed Google Scholar * Zhongling Zhu View author publications You can also

search for this author inPubMed Google Scholar * Zhao Yan View author publications You can also search for this author inPubMed Google Scholar CONTRIBUTIONS Zhao Yan and Zhongling Zhu

conceived the experiments; Fengxia Ding and Meisa Wang performed the experiments; Fengxia Ding, Meisa Wang, Yibo Du and Shuangshuang Du wrote the manuscript. ETHICS DECLARATIONS COMPETING

INTERESTS The authors declare no competing financial interests. RIGHTS AND PERMISSIONS This work is licensed under a Creative Commons Attribution 4.0 International License. The images or

other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the

Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit

http://creativecommons.org/licenses/by/4.0/ Reprints and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Ding, F., Wang, M., Du, Y. _et al._ BHX Inhibits the Wnt Signaling Pathway by

Suppressing β-catenin Transcription in the Nucleus. _Sci Rep_ 6, 38331 (2016). https://doi.org/10.1038/srep38331 Download citation * Received: 07 September 2016 * Accepted: 08 November 2016

* Published: 02 December 2016 * DOI: https://doi.org/10.1038/srep38331 SHARE THIS ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link

Sorry, a shareable link is not currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative