Immune activation influences samhd1 expression and vpx-mediated samhd1 degradation during chronic hiv-1 infection

Nature

Immune activation influences samhd1 expression and vpx-mediated samhd1 degradation during chronic hiv-1 infection"


Play all audios:

Loading...

ABSTRACT SAMHD1 restricts human immunodeficiency virus type 1 (HIV-1) replication in myeloid cells and CD4+ T cells, while Vpx can mediate SAMHD1 degradation to promote HIV-1 replication.


Although the restriction mechanisms of SAMHD1 have been well-described, SAMHD1 expression and Vpx-mediated SAMHD1 degradation during chronic HIV-1 infection were poorly understood. Flow


cytometric analysis was used to directly visualize _ex vivo_, and after _in vitro_ SIV-Vpx treatment, SAMHD1 expression in CD4+ T cells and monocytes. Here we report activated CD4+ T cells


without SAMHD1 expression were severely reduced, and SAMHD1 in CD4+ T cells became susceptible to SIV-Vpx mediated degradation during chronic HIV-1 infection, which was absent from


uninfected donors. These alterations were irreversible, even after long-term fully suppressive antiretroviral treatment. Although SAMHD1 expression in CD4+ T cells and monocytes was not


found to correlate with plasma viral load, Vpx-mediated SAMHD1 degradation was associated with indicators of immune activation. _In vitro_ assays further revealed that T-cell activation and


an upregulated IFN-I pathway contributed to these altered SAMHD1 properties. These findings provide insight into how immune activation during HIV-1 infection leads to irreparable aberrations


in restriction factors and in subsequent viral evasion from host antiviral defenses. SIMILAR CONTENT BEING VIEWED BY OTHERS HIV-2 VPX NEUTRALIZES HOST RESTRICTION FACTOR SAMHD1 TO PROMOTE


VIRAL PATHOGENESIS Article Open access 25 October 2021 PERIPHERAL BLOOD CD4+CCR6+ COMPARTMENT DIFFERENTIATES HIV-1 INFECTED OR SEROPOSITIVE ELITE CONTROLLERS FROM LONG-TERM SUCCESSFULLY


TREATED INDIVIDUALS Article Open access 13 April 2022 SELECTIVE CELL DEATH IN HIV-1-INFECTED CELLS BY DDX3 INHIBITORS LEADS TO DEPLETION OF THE INDUCIBLE RESERVOIR Article Open access 30


April 2021 INTRODUCTION SAMHD1 is an HIV-1 infection restriction factor. It potently restricts reverse transcription in myeloid cells and resting CD4+ T cells by hydrolyzing intracellular


dNTPs or degrading newly synthesized viral RNA1,2,3,4, which is removable through DCAF1-CUL4/DDB1-E3 ubiquitin ligase complex mediated proteasome degradation upon simian immunodeficiency


virus (SIV) derived Vpx treatment5. SAMHD1 is expressed abundantly in immune cells, including DC cells, B cells, monocytes and T cells6. Despite the reported inhibition of HIV-1 replication


by numerous _in vitro_ systems6,7,8,9, the relevance of SAMHD1 to HIV-1 pathogenesis _in vivo_ remains controversial. Previous studies have demonstrated that HIV-1 elite controllers maintain


higher levels of SAMHD1 transcripts than viraemic progressors do in PBMCs10,11. However, regulation of SAMHD1 is not found to correlate with viral load in SIV and HIV-2 infection


models12,13. Therefore, the expression and distribution of SAMHD1 protein in subsets of HIV-1 target cells and its relationship with _in vivo_ HIV replication in chronic HIV-1 infection need


to be further investigated. HIV-1 infection leads to chronic immune activation, functional impairment and gradual loss of CD4+ T cells, and ultimately Acquired Immune Deficiency Syndrome


(AIDS) if combination antiretroviral therapy (cART) was not available14. Non-replicating HIV-1 virions can induce the activation of CD4+ T cells, and cause massive CD4+ T cells depletion by


direct cell lysis and bystander apoptosis15,16. It is well known that activated CD4+ T cells are highly permissive to HIV-1 infection, whereas resting CD4+ T lymphocytes are refractory to


HIV-1 infection. Interestingly, SAMHD1 restricts HIV-1 replication only in resting CD4+ T cells6, although SAMHD1 is abundantly expressed in activated CD4+ T cells as well9. In addition,


upregulation of IFN-I pathway is one of markers that indicated persistent immune activation17. Sustained IFNα/β levels is associated with disease progression, and rapid progressors show


stronger IFNα/β signatures than viraemic non-progressors18,19. SAMHD1 in monocytes is reported to be up-regulated by IFN-α20. However, another study has shown that SAMHD1 is induced poorly


by IFN-α in monocytes and macrophages21. Since the regulation of SAMHD1 expression by immune activation is still obscure, we thus initiated experiments to investigate SAMHD1 expression in


association with _in vivo_ HIV-1 replication and immune activation during chronic HIV-1 infection. RESULTS CHARACTERIZATION OF SAMHD1 EXPRESSION BY FLOW CYTOMETRIC ANALYSIS We established a


multicolor flow cytometric staining assay to contemporaneously determine SAMHD1 expression in different leukocyte subsets, including CD4+ T cells and monocytes. First, we used intracellular


indirect immunofluorescence staining to evaluate SAMHD1 expression in cell lines. SAMHD1 expression was absent in Jurkat cells and present in most of the THP-1 cells (>92%), by 24 h of


SIV-Vpx treatment, the percentage of THP-1 cells that expressed high level of SAMHD1 declined to 7.46% (Fig. 1a). We also used short hairpin RNAs (shRNA) to generate SAMHD1-silent


(shSAMHD1-THP-1) and shRNA control THP-1 cells (shRNA Ctrl-THP-1). Compared with control cells, the percentage of SAMHD1 expressing cells decreased to 12.2% in the shSAMHD1-THP-1 cells. The


mean fluorescence intensity (MFI) of SAMHD1 was also reduced (Fig. 1a). The results of flow cytometric analysis were validated in parallel using western blotting (Fig. 1b). Next, PBMCs from


healthy controls (HCs) were stained using a cocktail of antibodies for CD4+ T cells and monocytes, and were then analyzed using flow cytometry. The fluorescence signal results for SAMHD1


indicated that PBMCs distinctly divided into two subgroups. One subgroup overlapped with the Fluorescence Minus One (FMO) control with all antibodies from the cocktail except that against


SAMHD1, and consisted of SAMHD1 negative (SAMHD1-) cells. The other subgroup with high fluorescence signal was defined as SAMHD1 positive cells (SAMHD1+) (Fig. 1c). Both subsets were sorted,


and SAMHD1 expression was confirmed using western blotting (Fig. 1d). These results indicated that flow cytometric analysis can distinguish cells that express SAMHD1 from their negative


counterparts. Because myeloid cells and CD4+ T cells from human peripheral blood are the primary target cells during HIV-1 infection, to this end, we examined SAMHD1 expression in these


cells. Most of the CD14+ monocytes (CD14+Mo), activated CD4+ T cells (CD69+CD4+T), and resting CD4+ T cells (CD69-CD4+T) exhibited high SAMHD1 levels (Fig. 1e). SAMHD1 EXPRESSION AND


VPX-MEDIATED SAMHD1 DEGRADATION IN CHRONIC HIV-1 INFECTED INDIVIDUALS HIV-1 mainly infected myeloid cells and CD4+ T cells, whether SAMHD1 expression in these subsets was influenced by HIV-1


remains unknown. To determine what happens to SAMHD1 expression during chronic HIV-1 infection, we employed this established flow cytometric method to analyze SAMHD1 expression in CD4+ T


cells and CD14+ monocytes from HIV-1 positive patients who were naïve to cART (cART- naïve) and HIV-1-infected patients who received prolonged cART with undetectable plasma HIV-1 levels


(referred as cART). Representative flow cytometry results are presented in Fig. 2a. No significant differences were found in the fraction of cells expressing SAMHD1 for resting CD4+ T cells


and monocytes from cART naïve and cART-treated patients (Fig. 2b). However, compared with those from healthy controls, we found that most of the SAMHD1- cells were absent from samples from


infected patients, and this absence was not restored by cART and resulted in a higher percentage of SAMHD1+ in the remaining cells (Fig. 2c). The MFI of SAMHD1 in the remaining activated


CD4+ T cells from the HIV-1 infected individuals was significantly higher compared with healthy donors (Supplementary Fig. S1). _In vitro_, SIV-Vpx mediated SAMHD1 degradation in monocytes,


macrophages, and dendritic cells. We examined whether HIV-1 infection resulted in changes in this SAMHD1 property in HIV-1 target cells. PBMCs were treated with SIV-Vpx for 48 h. The changes


in SAMHD1 expression in these three cell subsets were examined using flow cytometric analysis. SIV-Vpx treatment decreased the SAMHD1+ cell frequency in monocytes and activated CD4+ T


cells, but the SAMHD1+ cell frequency in resting CD4+ T cells was not affected (Fig. 2c). Loss of SAMHD1+ cells was most predominant in monocytes (58.8 ± 8.8%, 45.9 ± 12.5%, and 44.9 ± 14.9%


in the HC, cART- naïve, and cART cohorts, respectively). This result indicated that in a proportion of monocytes, SAMHD1 became refractory to SIV-Vpx mediated degradation in chronic HIV-1


infection (Fig. 2d). In particular, a subset of activated CD4+ T cells from cART-naïve (19.3 ± 13.9%) and from cART (21.5 ± 7.9%) patients was susceptible to SIV-Vpx mediated SAMHD1


degradation. In contrast, SIV-Vpx treatment had no effect on SAMHD1 in activated CD4+ T cells from healthy donors (Fig. 2d). Decrease in SAMHD1 expression after SIV-Vpx treatment was not


observed in resting CD4+ T cells (Fig. 2d). Consistent with the change in SAMHD1+ cell frequency, the levels of SAMHD1 also decreased in activated CD4+ T cells and monocytes, but not in


resting CD4+ T cells (Supplementary Fig. S2). These data indicated HIV-1 infection resulted in increased SAMHD1 expression in activated CD4+ T cells. However, the sensitivity of SAMHD1 to


SIV-Vpx in different cells was not consistent, monocytes were the most susceptible to Vpx- mediated degradation, activated CD4+ T cells were less, resting CD4+ T cells were the least.


ASSOCIATION BETWEEN SAMHD1 PROTEIN LEVELS AND _IN VIVO_ HIV-1 REPLICATION Within the group of untreated HIV-1 infected patients, we next investigated whether SAMHD1 expression in these HIV-1


target cells correlated with plasma HIV-1 viral load, the laboratory indicator for _in vivo_ HIV-1 replication. Because constitutively high SAMHD1 expression occurred in activated CD4+ T


cells, resting CD4+ T cells, and monocytes, no significant correlations were observed between SAMHD1 expression and plasma viral load (Fig. 3a). To further illustrate this issue, we divided


cART-naïve patients into chronic high viremia (CHVIR) with a viral load persistently >10000 copies per mL plasma and viremic controllers (VC) with a viral load persistently <2000


copies per mL plasma, and compared SAMHD1 levels of both groups. There were no significant differences in CD69+CD4+ T cells, CD69-CD4+ T cells, and monocytes (Fig. 3b). The between-group MFI


analysis of SAMHD1+ cells revealed that there were statistically significant differences in resting CD4+ T cells, but the magnitude of the differences was slight (Supplementary Fig. S3). In


conclusion, SAMHD1 expression in HIV-1 target cells was not associated with plasma viral load. To assess whether aberrant SIV-Vpx mediated SAMHD1 degradation was associated with _in vivo_


HIV-1 replication, we analyzed the relationship between the SAMHD1+ cell frequency susceptible to SIV-Vpx mediated degradation and plasma HIV-1 viral load. This correlation was not


significant between the frequency of SAMHD1+ cells susceptible to SIV-Vpx mediated degradation in activated CD4+ T cells and viral load (Fig. 3c, _p_ = 0.806). However, there was a


significant negative correlation when CD14+ monocytes were examined (Fig. 3d, _p_ = 0.005). In addition, SAMHD1+ cell frequency susceptible to SIV-Vpx mediated degradation in monocytes, but


not in activated CD4+ T cells, was greater in the VC group compared with the CHVIR group (Fig. 3e and f). These data indicated the degradation of SAMHD1 mediated by SIV-Vpx in monocytes was


related to plasma viral load, but it was not in activated CD4+ T cells. ASSOCIATION BETWEEN SIV-VPX MEDIATED SAMHD1 DEGRADATION AND PREDICTORS OF HIV DISEASE PROGRESSION What factors can


have an effect on Vpx-mediated SAMHD1 degradation except for plasma viral load? Next, we further investigated the relationship between SIV-Vpx mediated SAMHD1 degradation and HIV pathology,


including CD4+ T-cell counts, T-cell activation, and IFN-I pathway up-regulation. We found that the SAMHD1+ cell frequency susceptible to SIV-Vpx mediated degradation in activated CD4+ T


cells was positively correlated with the percentage of activated CD4+ T cells (Fig. 4c, _p_ = 0.027), but neither with CD4+ T-cell counts (Fig. 4a, _p_ = 0.932) nor with blood IFN-α levels


(Fig. 4e, _p_ = 0.058). In CD14+ monocytes, frequency of SAMHD1+ cells susceptible to SIV-Vpx mediated degradation was positively correlated with CD4+ T-cell count (Fig. 4b, _p_ = 0.014),


but was negatively correlated with the percentage of activated CD4+ T cells (Fig. 4d, _p_ = 0.02) and with blood IFN-α levels (Fig. 4f, _p_ = 0.049). These results showed that the


Vpx-mediated SAMHD1 degradation in activated CD4+ T cells was associated with CD4+ T cells activation, while that in monocytes was influenced by multiple factors, including CD4 T cell count,


IFN-α levels. REGULATION OF SAMHD1 BY IMMUNE ACTIVATION Above all, we see that SAMHD1 expression and SIV-Vpx mediated SAMHD1 degradation have been changed in chronic HIV-1 infection. As we


all know, chronic HIV-1 infection is characterized by immune activation, which could regulate SAMHD1 expression _in vivo_22. To investigate whether SAMHD1 expression and degradation are


associated with host immune activation, we first analyzed the effects of immune activation on SAMHD1 expression and Vpx-mediated degradation, in CD4+ T cells. Representative flow cytometry


results are shown in Fig. 5a. Twenty-four hours after PMA plus Ionomycin stimulation, the SAMHD1+ CD4+ T-cell number decreased from 97.8% ± 0.7% to 90.2% ± 5.5%; SIV-Vpx treatment resulted


in a further reduction, from 90.2% ± 5.5% to 74.8% ± 10.1% (Fig. 5b). Next, we explored the effects of immune activation on SAMHD1 expression and Vpx- mediated loss of SAMHD1 in monocytes.


Monocytes express a variety of Toll-like receptors (TLRs) and are susceptible to microbial products translocated through compromised gut mucosa23,24. We first examined the effects of


stimulation of various TLR’s agonists on SAMHD1 expression and Vpx-mediated loss of SAMHD1 in monocytes. We found that TLR2, TLR3, TLR4, TLR7, and TLR8 agonists did not affect expression or


SIV-Vpx mediated degradation of SAMHD1 (Supplementary Fig. S4). The IFN-I pathway is activated during chronic HIV-1 infection, and SAMHD1 was reported as IFN stimulated gene17,20,25. We


treated CD4+ T cells and monocytes with IFN-α, but SAMHD1 expression did not be changed in these cells (Supplementary Fig. S5). IFN-α did induce a dose-dependent inhibition of SIV-Vpx


mediated SAMHD1 degradation in monocytes (Supplementary Fig. S6). To further validate the role of IFN-α on SAMHD1 expression and degradation, we treated PBMCs from 15 HIV-1 infected


individuals with IFN-α, or SIV-Vpx, or with a combination of IFN-α and SIV-Vpx. A representative flow cytometry result is presented in Fig. 5c. SAMHD1+ cells in monocytes were decreased by


55 ± 12.2% after SIV-Vpx treatment, and this decrease was blocked in the presence of IFN-α. In activated CD4+ T cells, the frequency of SAMHD1+ cells was reduced by 17.4 ± 9.3% after SIV-Vpx


treatment. Stimulation with IFN-α had no effect on Vpx-mediated SAMHD1 degradation. In resting CD4+ T cells, the frequency of SAMHD1+ cells remained unchanged after SIV-Vpx or IFN-a


treatment (Fig. 5d). Western blotting was used to further confirm these results in purified CD4+ T cells and monocytes (Fig. 5e). These results suggest that HIV-1 infection-induced CD4+


T-cell activation explains why activated CD4+ T cells in chronically HIV-1 infected patients are susceptible to degradation by SIV-Vpx. Moreover, upregulation of the IFN-I pathway


antagonized Vpx-mediated SAMHD1 degradation in monocytes. DISCUSSION We found aberrant alterations in SAMHD1 in HIV-1 target cells that could be explained by the immune activation caused by


HIV-1 infection. HIV-1 infection leads to depletion of SAMHD1- cells in activated CD4+ T cells. Long-term cART will not restore this cell subset. This result is consistent with the result of


another study, which revealed that SAMHD1- activated CD4+ T cells are more permissive to HIV-1 infection and thus might lead to the loss of this cell subset in HIV-1 infected patients26.


SAMHD1 is a host enzyme that participates in the metabolism of DNA via regulation of intracellular dNTP levels2. Lower levels of SAMHD1 in activated CD4+ T cells may condition the cells


susceptible to activation induced apoptosis or pyroptosis. Relatively higher levels of SAMHD1 would preserve the remaining activated CD4+ T cells from the inflammatory microenvironment


present in chronically infected patients. In PBMCs, HIV-1 elite controllers maintain higher levels of SAMHD1 transcripts than do viremic progressors10,11. We examined SAMHD1 expression at


protein levels comparable to those of previous studies12,13. No evidence was found for an association between SAMHD1 expression and HIV-1 replication _in vivo_, given SAMHD1 is


constitutively expressed by HIV-1 target cells. However, when we treated cells with SIV-Vpx, a subset of activated CD4+ T cells, but not resting CD4+ T cells, became susceptible to


Vpx-mediated SAMHD1 degradation. A proportion of monocytes were refractory to SAMHD1 degradation by SIV-Vpx. Upon SIV-Vpx treatment, SAMHD1 was degraded via the DCAF1-CUL4/DDB1-E3 ubiquitin


ligase complex. The biochemical mechanism involved in the differential susceptibility of SAMHD1 in primary cells remains unknown. There are several avenues for further investigations,


including whether the cells express less of the ubiquitin ligase complex? Is SAMHD1 modified so that it can no longer interact with the ubiquitin ligase complex or with Vpx? Is the SAMHD1 in


these various cell populations active or inactive to restrict HIV replication or metabolism of DNA? There is no Vpx expression in HIV-1 or none of viral proteins from HIV-1 could lead to


SAMHD1 degradation, thus the altered susceptibility of SAMHD1 to Vpx-mediated degradation observed in our study is caused by host factors rather than viral factors. We treated cells with Vpx


and observed SAMHD1 degradation to evaluate the efficiency of machinery conducting SAMHD1 degradation. Our _in vitro_ assay results suggested that cellular activation of CD4+ T cells


promotes SAMHD1 degradation. The number of activated CD4+ T cells in HIV-1 infected patients was significantly higher than that of healthy controls, and the frequency of SAMHD1+ activated


CD4+ T cells susceptible to SIV-Vpx mediated degradation was in proportion to the percentage of activated CD4+ T cells, but did not correlate with HIV-1 viral load. Therefore, SAMHD1 in


SAMHD1+ CD4+ T cells became susceptible to SIV-Vpx mediated degradation during chronic HIV-1 infection. This result implied that the aberration of SAMHD1 in CD4+ T cells was caused by T-cell


activation and may have contributed to loss of viral control. In the HIV-1 infected patients, a proportion of monocytes was refractory to SAMHD1 degradation by SIV-Vpx. Microbial products


translocated from a compromised gastrointestinal tract stimulate monocytes23. However, activation by microbial product has no effect on SAMHD1 degradation by SIV-Vpx in monocytes.


Interestingly, we found that IFN-α specifically antagonized SAMHD1 degradation by SIV-Vpx in monocytes, but not in CD4+ T cells. In HIV-1 infected patients, activation of the IFN-I pathway


is a strong disease progression predictor27. Taken together, these results indicate that _in vivo_ IFN-I sensitized monocytes become refractory to SIV-Vpx mediated degradation in HIV-1


infected patients, which negatively correlates with HIV-1 viral load. Further study will reveal whether monocytes with SAMHD1 refractory to SIV-Vpx mediated degradation support HIV-1


replication. After long-term suppression of HIV-1 replication by cART, these aberrations in SAMHD1 can’t be repaired. Many successfully treated HIV-1-infected individuals experience a


syndrome characterized by increased T-cell activation and evidence of heightened inflammation and coagulation responses28. This residual immune dysregulation syndrome might be sufficient for


maintaining the aberrations in SAMHD1. An alternative explanation is that long-term chronic immune activation may lead to irreparable dysfunctions in long lived CD4+ T cells or progenitors


of myeloid lineage cells. In addition, SAMHD1 function is related to cell cycle, SAMHD1 protein is phosphorylated at residue T592 by CDK kinase29. We respectively stimulated CD4+ T cells and


monocytes using PMA plus Ionomycin and IFN-α, and found that the transduction efficiency of SIV-Vpx was not influenced by cell activation and proliferation (Supplementary Fig. S7). However,


SAMHD1 phosphorylation was regulated in CD4+ T cells upon activation by PMA plus Ionomycin, but not in monocytes treated with IFN-α (Supplementary Fig. S8). PMA plus Ionomycin activated


CD4+ T cells significantly induced SAMHD1 phosphorylation at residue T592, and these phosphorylated SAMHD1 seemed not to be degraded by SIV-Vpx. This explained why SAMHD1 in activated CD4+ T


cells is unable to inhibit HIV-1 replication. In conclusion, these data indicate that only non-phosphorylated SAMHD1 of activated CD4+ T cells, but not resting CD4+ T cells, can be degraded


by SIV-Vpx. However, the difference of SIV-Vpx mediated SAMHD1 degradation between activated and resting CD4+ T cells needs to be further investigated. In conclusion, due to chronic immune


activation, the cells from chronic HIV-1 infected patients may have different characteristics with respect to SAMHD1 in comparison to healthy controls. Immune activation not only altered the


expression of SAMHD1 in CD4+ T cells, but also affected the susceptibility of SAMHD1 to SIV-Vpx in activated CD4+ T cells and monocytes. It may link to the different potential to support


HIV-1 replication in activated CD4+ T cells and resting CD4+ T cells. Whether the immune activation-induced rapid disease progression was related to the alteration of SAMHD1 requires further


investigation. Finally, these data give us a hint that HIV-1 has evolved a mechanism that utilized the host’s microenvironment to escape from SAMHD1 restriction without antagonism of viral


accessory protein. This mechanism would differ from those used by other restriction factors such as APOBEC3G30 and BST-231. Future studies should focus on the mechanisms of effects of immune


activation on SAMHD1 restriction of HIV-1 replication. SAMHD1 could also serve as a potential target for treating the immune activation that occurs during chronic HIV-1 infection. METHODS


SUBJECTS Subjects were recruited as previously described32,33. Thirty-nine subjects were HIV-1 infected individuals. Twenty-two of these were treatment naive to combination antiretroviral


therapy (cART); 17 received cART that controlled the plasma viral load (VL) to undetectable levels. Twenty-five subjects were HIV-1-seronegative volunteers who were included as healthy


controls (HC). The characteristics of the HIV-1 positive subjects are presented in Table 1. To evaluate the relevance of SAMHD1 expression with viremia, individuals were stratified into two


groups: untreated HIV-1-infected subjects with chronic viremia (CHVIR, VL>10000 copies/mL) and viremic controllers (VC, VL<2000 copies/mL), just as shown in Table 2. Blood IFN-α mRNA


levels (linear scale) were obtained from microarray data (GSE56837)32. The study protocol was approved by the Ethical Committee of the Shanghai Public Health Clinical Center. The methods


were carried out in accordance with the Declaration of Helsinki. Written informed consent was obtained from all participants. CELL LINES AND PRIMARY CELLS HEK 293 T cells were cultured in


DMEM (Gibco) containing 2 mM L-glutamine, 10% fetal bovine serum, 50 U/mL penicillin, and 50 μg/mL streptomycin sulfate. THP-1 cells and Jurkat cells were cultured in RPMI-1640 medium


(Gibco) supplemented with 10% FBS, penicillin (100 U/mL), streptomycin sulfate (100 mg/mL), and L-glutamine (2 mM). ShRNA silenced cell lines were generated via transduction of lentiviral


vectors encoding nonspecific shRNA (pLKO-nontarget) or shRNA specific to SAMHD1 (shSAMHD1#2 TRCN-0000343808, sequence: CCGGGCCATCATCTTGGAATCCAAACTCGAGTTTGGATTCCAAGATGATG GCTTTTTG, Sigma).


These cell lines were then selected for resistance to puromycin. Peripheral blood mononuclear cells (PBMCs) were isolated from fresh blood. CD14+ monocytes and CD4+ T cells were separated


from PBMCs using the EasySep™ Human Monocyte and CD4+ T cells Enrichment Kit (StemCell Technologies), respectively. Flow cytometry results indicated that cell purity was >95%. PLASMIDS


AND REAGENTS SIV3+Vpx+, SIV3+Vpx-, and VSV-G plasmids were provided by Andrea Cimarelli (Université de Lyon, Lyon, France). The lentiviral packaging plasmid psPAX2 was obtained from Addgene.


LPS was derived from _Escherichia coli_ O55:B5 (Sigma-Aldrich). Pam3CSK4, Poly IC HMW, ssRNA40, and R837 were purchased from InvivoGen. CELL STIMULATION Cells (106) were stimulated with


1000 U/mL rIFN-α2b (Invitrogen), 1 μM PMA plus 1 μg/mL Ionomycin (Abcam), 1 μg/mL Pam3CSK4, 20 μg/mL poly IC HMW, 1 μg/mL lipopolysaccharide (LPS), 1 μg/mL R837, or 1 μg/mL ssRNA40 for 24 h.


2 ng/mL SIV-Vpx or SIV-Mock was used to treat cells for 48 h. IMMUNOBLOT ANALYSIS Cells were lysed in Pierce IP Lysis Buffer (Thermo Fisher) containing a 1% protease inhibitor cocktail


(Sigma). Whole-cell lysates were resolved on SDS-PAGE, transferred to a 0.22 μm polyvinylidene fluoride membrane, and probed using rabbit anti-SAMHD1 polyclonal Ab (clone 1F9, Abcam), rabbit


anti-phospho-SAMHD1 (Thr592) Antibody (CST), mouse anti–β-actin mAb (Santa Cruz), and corresponding horseradish peroxidase (HRP)-conjugated secondary antibodies (Santa Cruz). Vpx protein


was detected by Anti-p24 (HIV-1/Clade A, B, C, Immune-Tech). VIRUS-LIKE PARTICLE PRODUCTION Virus-like particles (VLPs) containing or lacking Vpx were produced from HEK 293 T cells


co-transfected with SIV3+Vpx+ or SIV3+Vpx-, and VSV-G plasmids. The concentration of SIV-Vpx was measured using P27 ELISA (Biomerieux). For SAMHD1 shRNA virion packaging, SAMHD1 shRNA


plasmids, psPAX, and pVSV-G were co-transfected into HEK 293 T cells. FLOW CYTOMETRY Intracellular SAMHD1 staining was carried out as previously described9. Briefly, PBMCs were stained for


30 min at room temperature using a mixture of anti-CD14-APC, anti-CD69-APC-Cy7, and anti-CD3-PB antibodies. After the cells were washed, they were fixed for 30 min at room temperature using


BD Cytofix Fixation Buffer. Cells were permeabilized in BD Phosflow Perm Buffer III for 2 min at 4 °C in the dark and then were washed twice. Cells were then stained for 1 h with rabbit


anti-human SAMHD1 polyclonal antibodies (1:100, Proteintech), followed by a mixture of anti-CD4-PE, and donkey anti-rabbit Alexa Fluor 488, antibodies (1:200, Invitrogen), for an additional


1 h. After the washes, cells were detected using a BD FACSAria™ II Flow Cytometer. The antibodies used for flow cytometric analysis were PE-CD4 (Biolegend, PRA-T4), APC-CD14 (Biolegend,


HCD14), Pacific Blue-CD3 (Biolegend, UCHT1), APC-Cy7-CD69 (Biolegend, FN50), rabbit anti-human SAMHD1 pAb (Proteintech, 12586-1-AP), and Alexa Fluor® 488 donkey anti-rabbit IgG (H+L)


(Invitrogen, A-21206). Data were analyzed using FlowJo 7.6 software. STATISTICAL ANALYSIS Statistical analyses were performed using GraphPad Prism 5 software. The results were expressed as


Mean  ±  Standard Error of the Mean (SEM) values. The Mann-Whitney test was used to compare between-group differences. Comparisons of SIV-Vpx treatment in the same sample was achieved using


a paired sample _t-_test (Wilcoxon test). Correlations between variables were calculated using a Spearman rank correlation test. Differences were considered statistically significant when


the _p_-value was<0.05 (*_p _< 0.05; **_p _< 0.01; ***_p _< 0.001). ADDITIONAL INFORMATION HOW TO CITE THIS ARTICLE: Fu, W. _et al_. Immune Activation Influences SAMHD1


Expression and Vpx-mediated SAMHD1 Degradation during Chronic HIV-1 Infection. _Sci. Rep._ 6, 38162; doi: 10.1038/srep38162 (2016). PUBLISHER'S NOTE: Springer Nature remains neutral


with regard to jurisdictional claims in published maps and institutional affiliations. REFERENCES * Lahouassa, H. et al. SAMHD1 restricts the replication of human immunodeficiency virus type


1 by depleting the intracellular pool of deoxynucleoside triphosphates. Nat Immunol 13, 223–228, doi: 10.1038/ni.2236 (2012). Article  CAS  PubMed  PubMed Central  Google Scholar  *


Goldstone, D. C. et al. HIV-1 restriction factor SAMHD1 is a deoxynucleoside triphosphate triphosphohydrolase. Nature 480, 379–382, doi: 10.1038/nature10623 (2011). Article  ADS  CAS  PubMed


  Google Scholar  * Choi, J., Ryoo, J., Oh, C., Hwang, S. & Ahn, K. SAMHD1 specifically restricts retroviruses through its RNase activity. Retrovirology 12, 46, doi:


10.1186/s12977-015-0174-4 (2015). Article  CAS  PubMed  PubMed Central  Google Scholar  * Ryoo, J. et al. The ribonuclease activity of SAMHD1 is required for HIV-1 restriction. Nat Med 20,


936–941, doi: 10.1038/nm.3626 (2014). Article  CAS  PubMed  PubMed Central  Google Scholar  * Hofmann, H. et al. The Vpx lentiviral accessory protein targets SAMHD1 for degradation in the


nucleus. J Virol 86, 12552–12560, doi: 10.1128/jvi.01657-12 (2012). Article  CAS  PubMed  PubMed Central  Google Scholar  * Descours, B. et al. SAMHD1 restricts HIV-1 reverse transcription


in quiescent CD4(+) T-cells. Retrovirology 9, 87, doi: 10.1186/1742-4690-9-87 (2012). Article  CAS  PubMed  PubMed Central  Google Scholar  * Hrecka, K. et al. Vpx relieves inhibition of


HIV-1 infection of macrophages mediated by the SAMHD1 protein. Nature 474, 658–661, doi: 10.1038/nature10195 (2011). Article  CAS  PubMed  PubMed Central  Google Scholar  * Laguette, N. et


al. SAMHD1 is the dendritic- and myeloid-cell-specific HIV-1 restriction factor counteracted by Vpx. Nature 474, 654–657, doi: 10.1038/nature10117 (2011). Article  CAS  PubMed  PubMed


Central  Google Scholar  * Baldauf, H. M. et al. SAMHD1 restricts HIV-1 infection in resting CD4(+) T cells. Nat Med 18, 1682–1687, doi: 10.1038/nm.2964 (2012). Article  CAS  PubMed  Google


Scholar  * Buchanan, E. L., McAlexander, M. A. & Witwer, K. W. SAMHD1 expression in blood cells of HIV-1 elite suppressors and viraemic progressors. J Antimicrob Chemother 70, 954–956,


doi: 10.1093/jac/dku428 (2015). Article  CAS  PubMed  Google Scholar  * Riveira-Munoz, E. et al. Increased expression of SAMHD1 in a subset of HIV-1 elite controllers. J Antimicrob Chemother


69, 3057–3060, doi: 10.1093/jac/dku276%/ (c) The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For


Permissions, please e-mail: [email protected] (2014). Article  CAS  PubMed  Google Scholar  * Buchanan, E. L. et al. SAMHD1 transcript upregulation during SIV infection of the


central nervous system does not associate with reduced viral load. Sci Rep 6, 22629, doi: 10.1038/srep22629 (2016). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar  * Yu, H. et al.


The efficiency of Vpx-mediated SAMHD1 antagonism does not correlate with the potency of viral control in HIV-2-infected individuals. Retrovirology 10, 27, doi: 10.1186/1742-4690-10-27


(2013). Article  CAS  PubMed  PubMed Central  Google Scholar  * Hazenberg, M. D. et al. Persistent immune activation in HIV-1 infection is associated with progression to AIDS. AIDS 17,


1881–1888, doi: 10.1097/01.aids.0000076311.76477.6e (2003). Article  PubMed  Google Scholar  * Holm, G. H. & Gabuzda, D. Distinct mechanisms of CD4+ and CD8+ T-cell activation and


bystander apoptosis induced by human immunodeficiency virus type 1 virions. J Virol 79, 6299–6311, doi: 10.1128/jvi.79.10.6299-6311.2005 (2005). Article  CAS  PubMed  PubMed Central  Google


Scholar  * Doitsh, G. et al. Cell death by pyroptosis drives CD4 T-cell depletion in HIV-1 infection. Nature 505, 509–514, doi: 10.1038/nature12940 (2013). Article  ADS  CAS  Google Scholar


  * Cha, L. et al. Interferon-alpha, immune activation and immune dysfunction in treated HIV infection. Clin Transl Immunology 3, e10, doi: 10.1038/cti.2014.1 (2014). Article  CAS  PubMed 


PubMed Central  Google Scholar  * Rotger, M. et al. Comparative transcriptomics of extreme phenotypes of human HIV-1 infection and SIV infection in sooty mangabey and rhesus macaque. J Clin


Invest 121, 2391–2400, doi: 10.1172/jci45235 (2011). Article  CAS  PubMed  PubMed Central  Google Scholar  * Sandler, N. G. et al. Type I interferon responses in rhesus macaques prevent SIV


infection and slow disease progression. Nature 511, 601–605, doi: 10.1038/nature13554 (2014). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar  * Berger, A. et al. SAMHD1-deficient


CD14+ cells from individuals with Aicardi-Goutieres syndrome are highly susceptible to HIV-1 infection. PLoS Pathog 7, e1002425, doi: 10.1371/journal.ppat.1002425 (2011). Article  CAS 


PubMed  PubMed Central  Google Scholar  * Goujon, C. et al. Evidence for IFNalpha-induced, SAMHD1-independent inhibitors of early HIV-1 infection. Retrovirology 10, 23, doi:


10.1186/1742-4690-10-23 (2013). Article  CAS  PubMed  PubMed Central  Google Scholar  * Rajasuriar, R. et al. Persistent immune activation in chronic HIV infection: do any interventions


work? AIDS 27, 1199–1208, doi: 10.1097/QAD.0b013e32835ecb8b (2013). Article  PubMed  PubMed Central  Google Scholar  * Brenchley, J. M. et al. Microbial translocation is a cause of systemic


immune activation in chronic HIV infection. Nat Med 12, 1365–1371, doi: 10.1038/nm1511 (2006). Article  CAS  PubMed  Google Scholar  * Shan, L. & Siliciano, R. F. Unraveling the


relationship between microbial translocation and systemic immune activation in HIV infection. J Clin Invest 124, 2368–2371, doi: 10.1172/jci75799 (2014). Article  CAS  PubMed  PubMed Central


  Google Scholar  * Li, N., Zhang, W. & Cao, X. Identification of human homologue of mouse IFN-gamma induced protein from human dendritic cells. Immunol Lett 74, 221–224 (2000). Article


  CAS  Google Scholar  * Ruffin, N. et al. Low SAMHD1 expression following T-cell activation and proliferation renders CD4+ T cells susceptible to HIV-1. AIDS 29, 519–530, doi:


10.1097/qad.0000000000000594 (2015). Article  CAS  PubMed  PubMed Central  Google Scholar  * Hardy, G. A. et al. Interferon-alpha is the primary plasma type-I IFN in HIV-1 infection and


correlates with immune activation and disease markers. PLoS One 8, e56527, doi: 10.1371/journal.pone.0056527 (2013). Article  ADS  CAS  PubMed  PubMed Central  Google Scholar  * Lederman, M.


M., Funderburg, N. T., Sekaly, R. P., Klatt, N. R. & Hunt, P. W. Residual immune dysregulation syndrome in treated HIV infection. Adv Immunol 119, 51–83, doi:


10.1016/B978-0-12-407707-2.00002-3%/ Copyright (c) 2013 Elsevier Inc. All rights reserved. (2013). Google Scholar  * Pauls, E. et al. Cell cycle control and HIV-1 susceptibility are linked


by CDK6-dependent CDK2 phosphorylation of SAMHD1 in myeloid and lymphoid cells. J Immunol 193, 1988–1997, doi: 10.4049/jimmunol.1400873 (2014). Article  CAS  PubMed  Google Scholar  *


Stopak, K., de Noronha, C., Yonemoto, W. & Greene, W. C. HIV-1 Vif blocks the antiviral activity of APOBEC3G by impairing both its translation and intracellular stability. Mol Cell 12,


591–601 (2003). Article  CAS  Google Scholar  * Mitchell, R. S. et al. Vpu antagonizes BST-2-mediated restriction of HIV-1 release via beta-TrCP and endo-lysosomal trafficking. PLoS Pathog


5, e1000450, doi: 10.1371/journal.ppat.1000450 (2009). Article  CAS  PubMed  PubMed Central  Google Scholar  * Xu, X. et al. IFN-stimulated gene LY6E in monocytes regulates the CD14/TLR4


pathway but inadequately restrains the hyperactivation of monocytes during chronic HIV-1 infection. J Immunol 193, 4125–4136, doi: 10.4049/jimmunol.1401249%/ Copyright (c) 2014 by The


American Association of Immunologists, Inc. (2014). Article  CAS  Google Scholar  * Tian, X. et al. The upregulation of LAG-3 on T cells defines a subpopulation with functional exhaustion


and correlates with disease progression in HIV-infected subjects. J Immunol 194, 3873–3882, doi: 10.4049/jimmunol.1402176%/ Copyright (c) 2015 by The American Association of Immunologists,


Inc. (2015). Article  CAS  Google Scholar  Download references ACKNOWLEDGEMENTS We thank all study participants for their donation of blood samples. We thank Anli Zhang, Yuan Dong, Jingjing


Yan, Jun Huang, Xiaolin Tian, YanminWan, Songhua Yuan, Xiangqin Ding, Yongquan He and Shuming Hao for contributions in sample collection and processing. We also thank Andrea Cimarelli and


Didier Trono for providing plasmids generously. This work was supported by National Natural Science Foundation of China Grant (81361128017, 31000413, 81571981), National Program on Key Basic


Research Project (2014CB542504),Excellent Doctoral Research Funding Scheme For Interdisciplinary from Fudan University (EZH1340310/004), and Open Research Fund Program of the State Key


Laboratory of Virology of China (2015IOV004). AUTHOR INFORMATION Author notes * Qiu Chao, Wang Ying and Xu Jianqing contributed equally to this work. AUTHORS AND AFFILIATIONS * Shanghai


Public Health Clinical Center, Institutes of Biomedical Sciences, Fudan University, Shanghai, China Weihui Fu, Chao Qiu, Mingzhe Zhou, Jianqing Xu & Xiaoyan Zhang * Key Laboratory of


Medical Molecular Virology of Ministry of Education/Health at Shanghai Medical College, Fudan University, Shanghai, China Weihui Fu, Chao Qiu, Mingzhe Zhou, Lingyan Zhu, Yu Yang, Chenli Qiu,


 Linxia Zhang, Xuan Xu, Jianqing Xu & Xiaoyan Zhang * Huashan Hospital, Fudan University, Shanghai, China Chao Qiu * Minhang Hospital, Fudan University, Shanghai, China Chao Qiu *


Shanghai Municipal Center for Disease Control & Prevention, Shanghai, China Ying Wang Authors * Weihui Fu View author publications You can also search for this author inPubMed Google


Scholar * Chao Qiu View author publications You can also search for this author inPubMed Google Scholar * Mingzhe Zhou View author publications You can also search for this author inPubMed 


Google Scholar * Lingyan Zhu View author publications You can also search for this author inPubMed Google Scholar * Yu Yang View author publications You can also search for this author


inPubMed Google Scholar * Chenli Qiu View author publications You can also search for this author inPubMed Google Scholar * Linxia Zhang View author publications You can also search for this


author inPubMed Google Scholar * Xuan Xu View author publications You can also search for this author inPubMed Google Scholar * Ying Wang View author publications You can also search for


this author inPubMed Google Scholar * Jianqing Xu View author publications You can also search for this author inPubMed Google Scholar * Xiaoyan Zhang View author publications You can also


search for this author inPubMed Google Scholar CONTRIBUTIONS X.Z. and J.X. provided financial support, organized the patients’ recruitment, supervised all experiments and revised the


manuscript; C.Q. conceived the study, designed all experiments, analyzed and interpreted the data, revised the manuscript; W.F. designed and performed experiments, analyzed the data and


wrote the manuscript; Y.W. provided data on viral loads. L.Z. provided the microarray data; Y.Y. participated in assistance for financial support; C.L.Q. provided us with data on CD4+ T cell


counts and technical assistance in FACS; X.X., L.Z. participated in the experiments for monocytes and CD4+ T cells separation; and X.Z., Y.W., J.X., and Chao Qiu coordinated the study. All


authors reviewed the manuscript. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare no competing financial interests. ELECTRONIC SUPPLEMENTARY MATERIAL SUPPLEMENTARY INFORMATION


RIGHTS AND PERMISSIONS This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the


article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission


from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/ Reprints and permissions ABOUT THIS ARTICLE CITE THIS


ARTICLE Fu, W., Qiu, C., Zhou, M. _et al._ Immune Activation Influences SAMHD1 Expression and Vpx-mediated SAMHD1 Degradation during Chronic HIV-1 Infection. _Sci Rep_ 6, 38162 (2016).


https://doi.org/10.1038/srep38162 Download citation * Received: 26 July 2016 * Accepted: 04 November 2016 * Published: 06 December 2016 * DOI: https://doi.org/10.1038/srep38162 SHARE THIS


ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link Sorry, a shareable link is not currently available for this article. Copy to clipboard


Provided by the Springer Nature SharedIt content-sharing initiative


Trending News

Dolly in nashville: authenticity that makes room for rhinestones

When the renowned radio personality and Grand Ole Opry fixture Bill Cody walked onto the stage at the Ryman Auditorioum ...

Tsung-dao lee obituary: boundary-breaking physicist who won nobel prize at just 30

Outside the Institute of High Energy Physics in Beijing stands a 5-metre-high metal sculpture. The round, swirling shape...

With the grain | Nature

Access through your institution Buy or subscribe This is a preview of subscription content, access via your institution ...

Author correction: therapeutic potential of klf2-induced exosomal micrornas in pulmonary hypertension

Correction to: _Nature Communications_https://doi.org/10.1038/s41467-020-14966-x, published online 4 March 2020. The ori...

Mathematical modelling: the cubic map in theory and practice

Access through your institution Buy or subscribe This is a preview of subscription content, access via your institution ...

Latests News

Immune activation influences samhd1 expression and vpx-mediated samhd1 degradation during chronic hiv-1 infection

ABSTRACT SAMHD1 restricts human immunodeficiency virus type 1 (HIV-1) replication in myeloid cells and CD4+ T cells, whi...

A Fourth State of Matter | Nature

ABSTRACT IN Mr. Crookes' communication on this subject (NATURE, vol. xxii. p. 153) occurs the sentence, “An isolate...

State of the News

Derby & Oaks Race Handicapping With the Pros Brad Yost On Oaks Friday, WFPL's State of the News headed to Churchill ...

Social media: generative ai could harm mental health

Tools that make use of generative artificial intelligence (AI) now feature on social-media platforms. These stand to boo...

No time for rhetoric | Nature

Nicolas Sarkozy must engage with French researchers if his much-needed science reforms are to succeed. In a speech on 22...

Top