Transition from freshwater to seawater reshapes the skin-associated microbiota of atlantic salmon
Transition from freshwater to seawater reshapes the skin-associated microbiota of atlantic salmon"
- Select a language for the TTS:
- UK English Female
- UK English Male
- US English Female
- US English Male
- Australian Female
- Australian Male
- Language selected: (auto detect) - EN
Play all audios:
ABSTRACT Knowledge concerning shifts in microbiota is important in order to elucidate the perturbations in the mucosal barrier during the transitional life stages of the host. In the present
study, a 16S rRNA gene sequencing technique was employed to examine the compositional changes and presumptive functions of the skin-associated bacterial communities of Atlantic salmon
reared under controlled laboratory conditions and transferred from freshwater to seawater. Proteobacteria was the dominant phylum in salmon from both freshwater (45%) and seawater (above
89%). Bacteroidetes, Actinobacteria, Firmicutes, Cyanobacteria and Verrucomicrobia were the most abundant phyla in salmon from freshwater. The transition to seawater influenced the OTU
richness and evenness. The high abundance (~62%) of the genus _Oleispira_ made Proteobacteria the most significantly abundant phylum in salmon from seawater. The predictive functional
profile suggested that the communities had the ability to extract energy from amino acids in order to maintain their metabolism and scavenge and biosynthesise compounds to make structural
changes and carry out signalling for their survival. These findings need to be further explored in relation to metabolic processes, the fish genotype and the environment. SIMILAR CONTENT
BEING VIEWED BY OTHERS LONGITUDINAL SAMPLING OF EXTERNAL MUCOSAE IN FARMED EUROPEAN SEABASS REVEALS THE IMPACT OF WATER TEMPERATURE ON BACTERIAL DYNAMICS Article Open access 21 June 2021
SEX-DEPENDENT EFFECTS OF MECHANICAL DELOUSING ON THE SKIN MICROBIOME OF BROODSTOCK ATLANTIC SALMON (_SALMO SALAR _L.) Article Open access 04 July 2023 ANALYZING BACTERIAL NETWORKS AND
INTERACTIONS IN SKIN AND GILLS OF _SPARUS AURATA_ WITH MICROALGAE-BASED ADDITIVE FEEDING Article Open access 30 December 2024 INTRODUCTION Mucosal surfaces of animals are colonised by
different species of bacteria, archaea, viruses and eukaryotic microorganisms that are either commensals, symbionts or opportunistic pathogens, which are collectively called the microbiome1.
In aquatic organisms, the mucosal surfaces are the primary protective barriers and harbour both beneficial and opportunistic pathogenic microorganisms2. Environmental conditions are known
to alter the microbiota of fish3. However, the skin-associated microbiota of fish has not been thoroughly investigated and the interrelationship of the microbiota with the environment is not
well known. The shifts in the skin-associated microbiota caused by the environmental changes may lead to the dominance of the opportunistic pathogenic bacteria, which may compromise the
health of the fish4. This information will be of interest to biologists and the fish farming industry. Atlantic salmon (_Salmo salar_ L.) is one of the major fish species that is grown
commercially for human consumption. Salmon are anadromous fish that undergo a physiological process termed smoltification. This process helps juvenile fish living in freshwater adapt to
their adult life in seawater (Supplementary Figure S1). In hatcheries, commercial salmon production is performed in two phases: the freshwater phase and the seawater phase. The freshwater
phase starts with spawning, followed by egg hatching and rearing until the fish smoltify. Immediately after smoltification, the fish are transferred to seawater. This phase of the transition
has been well-studied from physiological, immunological and pathological perspectives5. However, knowledge is lacking on the changes in the bacterial communities during this transition.
Skin and its mucosa are the primary barriers in the defence of fish6. Any change in the rearing environment of the fish is likely to affect the skin-associated microbial balance4,7,8.
Therefore, in the present study we investigated the shift in the skin-associated bacterial community of Atlantic salmon caused by the transfer of the fish from freshwater to seawater.
Additionally, we predicted the possible functions of the microbiota of Atlantic salmon maintained under controlled conditions in freshwater and seawater. RESULTS We employed Ion
semiconductor sequencing platform to sequence the variable region 4 (Amplicon length 357 bp) of the 16S rRNA gene. This study identified the spatial (freshwater vs seawater) and temporal
changes (time points in the seawater phase) in the skin-associated microbiota of Atlantic salmon. A total of 1,613,103 ± 9976 (Mean ± SD) quality-filtered reads were obtained from 38 samples
of the four study groups [FW (fish in freshwater), SW.1W (fish 1 week after transfer to seawater), SW.2W (fish 2 weeks after transfer to seawater) and SW.4W (fish 4 weeks after transfer to
seawater)] and the data are provided in Supplementary Table S1. The reads obtained from the different groups were classified into 952 OTUs at a 97% similarity level. SPECIES RICHNESS AND
DIVERSITY OF THE SKIN-ASSOCIATED MICROBIOTA OF ATLANTIC SALMON The rarefaction curves based on the alpha diversity metrics [the Chao1 (Fig. 1A) and PD (Phylogenetic diversity) whole tree
(Fig. 1B) indices] indicated the adequateness of 20,000 sequences per sample to capture the alpha diversity of the communities. The OTU richness and phylogenetic diversity were significantly
higher in SW compared to FW (Fig. 1C,D). Based on the Simpsons evenness index, the OTUs in SW.4W were significantly uneven compared to the communities of the other groups (Fig. 1E). The
evenness in SW.1W was similar to that in FW; however, this parameter was significantly lower in the other SW groups (Fig. 1E). These findings are well-supported by the rank abundance
analysis (Supplementary Figure S2). Beta diversity analyses using both unweighted and weighted UniFrac revealed that the FW and SW.4W communities were phylogenetically distant from each
other. Furthermore, these communities were phylogenetically distinct from SW.1W and SW.2W. The SW.1W and SW.2W communities clustered together, indicating a phylogenetic similarity between
these groups (Fig. 2A,B). UPGMA (Unweighted Pair Group Method with Arithmetic Mean) hierarchical clustering of the weighted UniFrac distances also demonstrated a grouping pattern similar to
that obtained by Principal Coordinates Analysis, PCoA (Supplementary Figure S3). RELATIVE ABUNDANCE OF THE PROMINENT TAXA IN THE SKIN-ASSOCIATED MICROBIOTA OF ATLANTIC SALMON A full list of
phyla (abundance ≥ 0.1%) and families (abundance ≥ 0.2%) is provided in Supplementary Tables S2 and S3, respectively. The taxonomic compositions of the skin-associated microbiota of salmon
in the freshwater and seawater groups were different based on relative abundances (Supplementary Table S2). In FW, Proteobacteria (45.2%) and Bacteroidetes (39.2%) were among the abundant
groups, followed by the Actinobacteria (5.2%), Firmicutes (4.2%) and Cyanobacteria (2.4%). In fish from seawater, Proteobacteria was the dominant phylum (89.2%, 87.4% and 93.5% in SW.1W,
SW.2W and SW.4W, respectively) and the abundance of Bacteroidetes, Actinobacteria and the Firmicutes was comparatively lower than their numbers in FW. Flavobacteriaceae (20.3%) was among the
abundant families in FW, along with Cytophagaceae (16.4%) and Comamonadaceae (13.6%). The most abundant family in SW.1W was Pseudoalteromonadaceae (14.3%), which increased its dominance by
week 2 (29.1%, the dominant type in SW.2W); however, this family had become relatively less dominant by week 4 (5.3%). Campylobacteraceae was the second most abundant group (13.1%) in SW.1W,
but its representation dropped by week 2 (1.2%) and increased again to 8.1% by week 4. In SW.2W, Oceanospirillaceae was the second most abundant type (9.2% abundance in SW.1W); it became
the dominant family in SW.4W by week 4 due to an increase in its percentage representation from 15.4% to 62.8%. In SW.1W and SW.2W, the third, fourth and fifth most abundant groups belonged
to Gammaproteobacteria. In SW.1W, Colwelliaceae (10.7%) was the fourth most dominant type; its representation decreased to 6.7% by week 2 and increased again to 8.7% to become the second
most dominant type in SW.4W. DIFFERENTIAL ABUNDANCES OF THE OTUS IN THE SKIN-ASSOCIATED MICROBIOTA OF ATLANTIC SALMON LEfSe [Linear Discriminant Analysis (LDA) Effect Size] was used to
detect the bacterial taxonomic biomarkers in FW and SW, resulting in the identification of 129 clades including both lowly and highly abundant bacteria. The significantly abundant taxa are
shown in Fig. 3, with their corresponding LDA scores. Proteobacteria, Bacteriodetes, Actinobacteria, Firmicutes, Verrucomicrobia, Cyanobacteria and SBR1093 were the phylum-level biomarkers.
Of these, all except Proteobacteria and SBR1093 were biomarkers of FW. Family-, genus- and species-level biomarkers are provided in the Supplementary Table S4. The class-level biomarkers of
Proteobacteria in FW belonged to Alpha- and Betaproteobacteria. In contrast, Gammaproteobacteria was the most abundant class in SW.4W; its dominance was driven by the highly abundant
_Oleispira_ OTU1. Epsilonproteobacteria was the most significantly abundant class in SW.1W. Additionally, one OTU each belonging to the Alpha-, Beta- and Gammaproteobacteria was abundant in
SW.1W. At the class-level, only 1 OTU (belonging to Alphaproteobacteria) was significantly abundant in SW.2W. Thirteen order-level biomarkers under the phylum Proteobacteria were identified
by LEfSe. These included five features in FW (Burkholderiales, Caulobacterales, Sphingomonadales, Rhizobiales and Xanthomonadales), 4 in SW.1W (Campylobacteriales, Alteromonadales and one
OTU each from Oceanospirillales and Alteromonadales), 3 in SW.2W (Vibrionales, Pseudomonadales and Rhodobacterales) and 1 in SW.4W (Oceanospirillales). The phylum-level abundance of
Bacteroidetes in FW was driven by class-level (Sphingobacteriia and Cytophagia) and order-level (Flavobacteriales and Cytophagales) biomarkers. All of the biomarkers identified under
Actinobacteria and Firmicutes belonged to the FW group. The class-level biomarkers under the phyla Actinobacteria and Firmicutes were identified as Actinobacteria and Bacilli, respectively.
At the order level, only the Actinomycetales biomarker was under Actinobacteria. In contrast, the phylum Firmicutes had 2 biomarkers (Lactobacillales and Bacillales). Although the
phylum-level abundance of Verrucomicrobia was evident in FW, the order-level biomarkers in Verrucomicrobia present in SW.1W (Pedosphaerales) and SW.4W (Pelagicoccales) did not belong to FW.
CORE AND SHARED OTUS IN THE DIFFERENT FISH GROUPS The shared and unique core OTUs shown in Fig. 4 are based on the OTUs present in 90% of the samples of a particular group (i.e. 9 fish out
of 9 or 10). Interestingly, 19 core OTUs were common in all 4 groups (Supplementary Table S5). Although these OTUs were present in most samples, it is important to note that there was a
significant difference in their abundance across groups. PRESUMPTIVE METABOLIC POTENTIAL OF THE SKIN-ASSOCIATED MICROBIOTA OF ATLANTIC SALMON Eleven functional pathways were enriched in both
FW and SW.1W. Two pathways were abundant in SW.2W and 15 significantly enriched pathways were found in SW.4W. The results are graphically represented using LDA scores in Fig. 5. DISCUSSION
In Atlantic salmon hatcheries, fry and parr are reared in freshwater. After smoltification, they are released into seawater. A change in the rearing environment is likely to alter the
bacterial community on the skin of farmed salmon. This hypothesis was tested in the present study. The richness, diversity and taxonomic composition of the skin-associated microbiota of
farmed Atlantic salmon were evaluated in freshwater and seawater. Additionally, the taxa shift during the 4-week seawater transition period and significant differences in the predicted
metabolic potential of the microbial community in the two rearing environments were assessed. In the present study, the approach was to compare the microbiota of the fish from the two
treatments - the differential abundance and diversity of the bacterial taxa on the fish mucus is discussed. However, the presence and importance of treatment-specific bacteria on salmon
mucus have to be interpreted with caution since water samples were not analysed and there were no tank replicates (i.e., for the treatments). The higher evenness in FW could indicate that a
stable bacterial community was established during the host’s life in freshwater (8 months in the hatchery and 2 months in the research station) because higher evenness is a feature of the
functional stability and resilience of the community9. The evenness decreased after entry into seawater and higher richness and phylogenetic diversity became the characteristics of the
seawater community. This transition is most likely a protracted process, possibly taking longer than the 4-week time line examined in the present study. However, the presence of few dominant
OTUs is the characteristic feature of the marine fish microbiota10. In terms of the phylogenetic similarities/differences, the FW community was distinct from its seawater counterparts and
the SW.4W community was different from the SW.1W and SW.2W communities. Taken together, these results suggest that the transfer of the fish from freshwater to seawater may disturb the
skin-associated community of Atlantic salmon. The phylum Proteobacteria had a high mean percentage representation in all of the study groups. However, the representation of the communities
belonging to Proteobacteria increased significantly upon entry into seawater. The second largest representative phylum in FW was Bacteriodetes (39.2%), which decreased significantly in fish
reared in seawater. These results and the high representation of the members of Proteobacteria in the shared core microbiota could indicate the importance of this phylum in the
skin-associated communities of Atlantic salmon. Psychrophiles are mostly Gram-negative Proteobacteria11 and therefore, it is not surprising to find Proteobacteria as the dominant phylum in a
cold water fish. In fact, none of the other significantly abundant phyla in FW (except Cyanobacteria) were present among the shared core OTUs. Furthermore, the significant abundance of the
members of the phylum Proteobacteria (class- to species-level) was not translated to the phylum-level abundance. The high abundance (~62%) of the genus _Oleispira_ in SW.4W (Fig. 3) made
Proteobacteria the most significantly abundant phylum in the seawater group. _Oleispira_ was also a shared core OTU (Supplementary Table S5). A species of _Oleispira_ (_O. antarctica_) was
described as a psychrophilic hydrocarbonoclastic bacteria12. The high abundance of bacteria belonging to this genus in salmon skin is intriguing and their presence in both the freshwater and
seawater phases could indicate their facultative nature. The class- to species-level (9 genera in FW and SW.1W and 5 genera in SW.2W) differential abundance of Proteobacteria was noted in
FW, SW.1W and SW.2W. A phylum-level differential abundance of Proteobacteria was detected in SW.4W. Moreover, although SW.1W and FW had a similar number of generic shifts, 4 OTUs of the same
genus (_Arcobacter_) were significantly more abundant in SW.1W. Similarly, 3 OTUs of the same genus (_Pseudoalteromonas_) were differentially abundant in SW.2W (Fig. 3). These results may
imply that these genera are the major drivers of the differences at this level of the taxon. Furthermore, _Arcobacter_ and _Pseudoalteromonas_ were present in the shared core OTUs
(Supplementary Table S5). Some species of the genus _Pseudoalteromonas_ are capable of synthesising extracellular compounds that can inhibit the colonisation of competing microbes13.
Therefore, these microbes might have outcompeted other communities due to their ability to produce antimicrobial compounds. Conversely, species belonging to the genus _Arcobacter_ are
reported to be harmful to the host. The pathological effects of _Arcobacter cryaerophilus_ on rainbow trout (_Oncorhynchus mykis_s) were reported previously14. Among several species of
_Pseudoalteromonas_ associated with cultured gilthead sea bream (_Sparus aurata_) and European sea bass (_Dicentrarchus labrax_), only one strain was pathogenic for the gilthead sea bream
and one strain was weakly virulent for the sea bass15. The significant abundance of these two types of skin-associated bacteria in Atlantic salmon during the transition is interesting,
particularly from a disease point of view. The characteristics of species belonging to _Stenotrophomonas_ (FW) and _Psychromonas_ (SW.1W), which were the two other core OTUs and genus-level
biomarkers, were described by others: _Psychromonas arctica_ is a biofilm-forming cold-tolerant bacterium isolated from seawater and sea ice11, and; _Stenotrophomonas maltophilia_ is
associated with infectious intussusception syndrome in the channel catfish _Ictalurus punctatus_16. Other genera under Proteobacteria (i.e., _Polynucleobacter_, _Rhodobacter_,
_Sphingomonas_, _Novosphingobium_, _Ochrobactrum_, _Pseudomonas_ and _Acinetobacter_) were also significantly abundant in FW. Association of the members of these genera with either aquatic
environments or aquatic organisms has been reported previously. _Polynucleobacter necessarius asymbioticus_ is known for its ubiquitous presence in lentic freshwater habitats17. _Rhodobacter
veldkampii_ was isolated from the gill samples of Atlantic salmon subjected to a freshwater bath to prevent gill disease caused by _Neoparamoeba pemaquidensis_18. The genera, _Sphingomonas_
and _Novosphingobium_, were found in the intestine of farmed rainbow trout19 and they assisted in the metabolism of nitrogenous compounds20. Furthermore, they include species that can
degrade aromatic compounds21,22. In the present study, pathways related to the degradation of aromatic compounds were found to be enriched in FW and these 2 genera might have been the key
contributors. _Ochrobactrum_ was found to be associated with both polluted soil23 and the intestine of Atlantic cod24. The _Pseudomonas_ genus was present in both the skin and gills of
Atlantic salmon18. Two commensal bacteria belonging to _Pseudomonas_ and _Psychrobacter_ were isolated from wild Atlantic cod25. _Acinetobacter_ was also present in the skin and gills of
Atlantic salmon18. The species _Acinetobacter rhizosphaerae_ is another biomarker of the FW group. _Thalassomonas_, _Psychromonas_, _Agarivorans_, _Pseudoalteromonas_, _Marinomonas_,
_Arcobacter_, _Perlucidibaca_, _Octadecabacter_ and _Oleispira_ (all belonging to the phylum Proteobacteria) were the biomarkers of the SW groups. Previous reports indicated the presence of
members belonging to the aforementioned genera in the intestine of wild-caught shrimp (_Thalassomonas_ sp.)26, Atlantic halibut larvae (_Marinomonas_ and _Pseudomonas_)27, sediments of
aquaculture sites (_Agarivorans albus_)28, freshwater (_Perlucidibaca piscinae_)29 and Antarctic sea and Arctic sea ice (_Octadecabacter_)30. Bacteroidetes was the second dominant type in
all groups and a phylum-level abundance was noted in FW. Furthermore, Firmicutes, Actinobacteria, Verrucomicrobia and Cyanobacteria were significantly abundant in FW. Several genera (i.e.,
_Flectobacillus_, _Flavobacterium_, _Polaribacter_, _Tenacibaculum_, _Rhodococcus_ and _Staphylococcus_) contributed to these phylum-level abundances in the FW and SW groups. The functional
roles of the members of these bacterial genera that are present in the mucus of Atlantic salmon have to be ascertained through further studies, especially because some of them are known fish
pathogens31,32,33,34. On the other hand, some of the bacteria could be part of a healthy skin microbiome of the fish. The genus-level biomarkers indicate that the FW group is characterised
by the significant abundance of several members of Proteobacteria, Bacteriodetes, Actinobacteria and Firmicutes and some species under these phyla also include known opportunistic bacteria.
Although diverse bacteria colonised the skin of the SW groups, only a few clades were found to be significantly abundant compared to the FW group. Atlantic salmon had a significant abundance
of clades that include opportunistic bacteria belonging to Proteobacteria and Bacteriodetes in their skin, even 1 week after transfer to seawater. However, the composition of such
opportunistic clades decreased by the second week. Furthermore, the significant abundance of the genus of a psychrophilic Proteobacteria in SW.4W could be indicative of the ability of a
cold-tolerant bacterial type to establish its dominance in its niche. The global changes in the presumptive functions of the skin-associated microbial community of Atlantic salmon were also
examined by predicting the metagenomes using PICRUSt. The accuracy of the prediction was evaluated by computing NSTI (Nearest Sequenced Taxon Index) - the NSTI scores ranged between 0.10 and
0.17. Eleven functional pathways were found to be abundant in FW, including those related to the metabolism of ether lipid and ascorbate-aldarate, biosynthesis of glycosaminoglycan,
phosphotransferase system (PTS), non-homologous end joining (NHEJ), ATP-binding cassette (ABC) transporter and degradation of several aromatic compounds. The skin microbiota of Atlantic
salmon in week 1 of the seawater phase was linked to 11 pathways: metabolism of arginine, proline, glutathione, glycine, serine, threonine, tryptophan, phosphonate, phosphinate, α-linolenic
acid; biosynthesis of lysine, 12-, 14-, 16-membered macrolides and unsaturated fatty acids; and degradation of lysine and branched-chain amino acids (valine, leucine and isoleucine).
Bacteria can metabolise amino acids or fatty acids to derive energy for their growth35. Some bacteria such as lactic acid bacteria (LAB) can derive pyruvate and lactate from carbohydrates,
organic acids and amino acids, with amino acids serving as the main substrates in this process. The pathways may indicate the ability of the bacteria to extract energy from amino acids and
maintain their metabolism during adaptation to seawater. Glutathione reserves are used by the bacteria to protect their cells from external pressures, such as low pH, cold and oxidative and
osmotic stresses36. Fifteen pathways were attributed to the skin microbiota of Atlantic salmon in seawater after 4 weeks. This finding indicates that the SW.4W group has bacteria that can
synthesise and/or scavenge lipoate37 and metabolise selenite into selenomethionine, selenocysteine/selenocystine and selenocystathionine38. The bacterial community can use
sulfate/thiosulfate/sulfonates/methionine/cysteine-derived compounds (glutathione) as sulfur sources, use serine to synthesise cysteine, or take up cysteine directly from the environment via
ABC transporters or symporters39. The microorganisms can biosynthesise and transport methionine40,41 and synthesise physical barrier-providing molecules called peptidoglycans42.
Furthermore, they are able to metabolise amino sugars and nucleotide sugars, possibly for cell wall/exopolysaccharide synthesis43. The members of the community can form biofilms via
galactose metabolism44, produce lipopolysaccharides (LPS) to maintain the outer-membrane permeability barrier integrity and contribute to host-pathogen interactions by effectively
synthesising and exporting LPS45,46. The identified members can also metabolise sphingolipids (membrane constituents and cell signalling molecules) and survive using sphingolipid
signalling47,48. Thus, the skin-associated bacteria of Atlantic salmon reared in seawater could possibly scavenge and biosynthesise compounds to make structural changes and carry out
signalling for their survival. CONCLUSION The dominance of Proteobacteria in the skin-associated microbiota of Atlantic salmon is evident from the current findings. The transition from
freshwater to seawater destabilised the skin bacterial community, leading to an increase in phylogenetic diversity in the fish mucus of Atlantic salmon in seawater. The significant abundance
of the Proteobacteria phylum in freshwater fish was driven by multiple clades (downwards from the class-level). The phyla Bacteriodetes, Actinobacteria, Firmicutes, Verrucomicrobia and
Cyanobacteria were also significantly abundant in the freshwater fish. Although diverse bacteria colonise the skin of Atlantic salmon in seawater, only a few clades (Proteobacteria,
Bacteriodetes, Cyanobacteria, Verrucomicrobia and SBR1093) were found to be significantly abundant. The abundance of some clades, which include known opportunistic bacteria, in the
freshwater fish appeared to diminish during the switch to seawater life. The roles of these bacteria can be explained only after conducting functional studies. The dominance of the
psychrophilic genus _Oleispira_ in fish adapted to seawater needs to be ascertained in order to clarify the importance of the bacteria. The presumptive functional content of the bacterial
community during the transition stages could indicate their ability to extract energy from amino acids to maintain their metabolism and scavenge and biosynthesise compounds to make
structural changes and carry out signalling for their survival. The community profiles revealed in this study could facilitate further investigations on specific bacterial groups to reveal
their relevance to Atlantic salmon during the physiological changes accompanying smoltification. The significant findings need to be further explored in relation to metabolic processes, the
fish genotype and the environment. METHODS STUDY DESIGN Atlantic salmon (0 year class from the freshwater production stage), obtained from the hatchery of Cermaq Norway AS (Bodø, Norway),
were maintained at the Research Station, Nord University, Norway. They were reared in 500 L tanks that were part of a freshwater (city water supply, 12 °C) flow-through system and were
offered a commercial feed from EWOS (Bergen, Norway). The fish were maintained in freshwater, at the Research Station, for approximately 2 months before the sampling. Initial samples (FW)
were collected from these fish and then fifty fish were transferred to the seawater (drawn from a depth of 50 m in Saltfjorden) tank (500 L) of another flow-through system (12 °C). Following
introduction of the fish into seawater (salinity 35 g/kg), samples were obtained at 1 (SW.1W), 2 (SW.2W) and 4 weeks (SW.4W). During this period, the fish were fed the same diet mentioned
above. The experiment was conducted under controlled conditions: the photoperiod in the laboratory was 12L:12D, the temperature of the rearing water was 12 °C and the dissolved oxygen was
above 90%. The water used in both the FW and SW systems was initially filtered through a drum filter (25 micron) and then passed through a protein skimmer. Next, the water was treated with
UV light and finally filtered through a 6 micron filter. SAMPLING The fish were anaesthetised using MS-222 (80 mg/L Tricaine methanesulphonate, Argent Chemical Laboratories, Redmond, WA,
USA) prior to sampling. At each sampling time point, skin mucus samples (n = 9 or 10 fish; mean ± SD = 88.8 ± 2.8 g) were gently scraped from the entire body surface of the fish (excluding
the regions close to the anus and the gill opening) using sterile glass slides. The mucus samples were transferred to cryotubes, flash frozen in liquid nitrogen and stored at –80 °C prior to
processing. The handling and sampling procedures were conducted according to the authorised protocols of the Norwegian Animal Research Authority (FDU) and the study was approved by FDU
(approval number: 7899). DNA EXTRACTION DNA from the samples was extracted using the QIAamp DNA Stool Mini Kit (Qiagen, Nydalen, Sweden). The samples were mixed with ASL buffer from the kit
at a 1:10 ratio and vortexed using the Vortex Gene 2 (Scientific Industries, Bohemia, NY, USA). The manufacturer’s protocol was slightly modified to improve the lysis of cells and increase
the DNA yield. The modifications were as follows: in step 1, the samples were homogenised with the ASL buffer for 10 min and in step 3, the samples were heated at 70 °C for 10 min. PCR
AMPLIFICATION OF THE V4 REGION OF THE 16S RRNA GENE AND SEQUENCING The DNA concentration of each sample was measured using the Qubit® dsDNA BR Assay Kit (Life Technologies, Grand Island, NY,
USA) in combination with the Qubit® 2.0 Fluorometer (Life Technologies). The V4 region of the 16S rRNA gene was amplified by the fusion primer method using the primers 515F
(GTGCCAGCMGCCGCGGTAA) and 806R (GGACTACHVGGGTWTCTAAT). These primers were shown to be ideal to amplify the V4 region with high coverage and the amplicons (read length) are suitable for the
Ion Torrent™ sequencing platform (Life Technologies)49. Variable region 4 was selected because sequencing and taxonomic assignment using this region was associated with a low error rate and
minimum loss of taxonomic resolution50,51. The gene- specific primers were modified in the following manner: forward primer = 5′ Ion adapter A (CCATCTCATCCCTGCGTGTCTCCGAC)/4-base key
(TCAG)/Ion Xpress™ barcode (sample specific)/3-base separator (GAT)/515F (GTGCCAGCMGCCGCGGTAA) 3′ and reverse primer = 5′ Ion adapter trp1 (CCTCTCTATGGGCAGTCGGTGAT)/806R
(GGACTACHVGGGTWTCTAAT) 3′. Full-length primer sequences (including the barcodes) that were used for the amplification of the V4 region in the individual samples are listed in Supplementary
Table S1. All PCR reactions were performed in duplicate in a 50 μl reaction mixture, comprising 45 μl of Platinum® PCR SuperMix High Fidelity (Life Technologies), 1 μl of the sample-specific
primer mix (200 nM) and 4 μl of the DNA template (~200 ng). A negative PCR control without the DNA template was also included in the run. Thermocycling conditions included an initial
denaturation at 94 °C for 5 min, followed by 35 cycles of denaturation at 94 °C for 30 sec, annealing at 56 °C for 30 sec and extension at 68 °C for 45 sec. After the cycling procedure, the
PCR products corresponding to each sample were pooled and run on a 1.2% agarose gel for the separation of amplicons from the leftover primers and primer-dimers. The positive bands (~357 bp)
were excised from the gel and purified using the E.Z.N.A. Gel Extraction Kit (Omega bio-tek, Norcross, GA, USA). The negative control did not show any amplification. Amplicon libraries were
quantified using the KAPA Library Quantification Kit (Kapa Biosystems, Woburn, MA, USA) for the Ion Torrent™ platform according to the manufacturer’s protocol. Briefly, each amplicon library
was serially diluted (1:500, 1:1000, 1:2000 and 1:4000) and qPCR was performed on each of the dilutions of the libraries in a reaction mixture comprising the KAPA SYBR FAST qPCR master mix
containing the primer premix (12 μl), PCR-grade water (4 μl) and the diluted library or DNA standard (4 μl). The Cq values corresponding to the different libraries and the values
corresponding to the DNA standards were used to calculate the size-corrected dilution factor for each sample as explained in the kit protocol. Each amplicon library was subsequently diluted
with low TE buffer to obtain a concentration of 26 pM (~15.6 million molecules/μl). Then, 5 μl of each of the diluted libraries (26 pM) was pooled prior to the emulsion PCR. The emulsion PCR
was performed using the Ion PGM™ Template OT2 400 Kit (Life Technologies) following the manufacturer’s instructions. The libraries were sequenced using the Ion 318™ Chip Kit v2 (Life
Technologies) on the Ion Torrent PGM™ system employing the Ion PGM™ Sequencing 400 Kit (Life Technologies). Initial quality filtration of the sequence data, such as the removal of polyclonal
and low quality reads, adapter sequences and the barcode sequences, was performed by the Torrent Suite™ Software (Life Technologies). The FASTQ files corresponding to each sample were used
for analysis. DATA ANALYSES The 16S rRNA gene data were analysed using QIIME version 1.8.052 and UPARSE version 7.0.109053. Sequences were first quality filtered by discarding reads: i) that
fell outside the length range of 290 to 300 bp; ii) with a Phred score below 25 over a window of 50 nucleotides; and iii) with homopolymers and ambiguous base-pairs exceeding 6. The
resulting quality-filtered FASTA files were merged. Then, the sequences were trimmed to 250 bp, dereplicated and abundance sorted and sequences with <10 reads were discarded. A _de novo_
OTU-picking was performed on the quality-filtered and sorted sequences. Subsequently, UCHIME version 4.2.40 was employed to perform a reference-based chimaera check54. The reads were mapped
to the OTUs by searching the reads as a query set against the OTU representative sequences. Only OTUs present in at least 3 samples with an abundance ≥0.001% were retained for further
analysis. The sequences were assigned to the lowest possible taxonomic rank using UCLUST version 1.2.2255 by considering ten database hits with a similarity level of 0.9 employing the
Greengenes56 reference database (release gg_13_8). A phylogenetic tree was constructed using FastTree version 2.1.757. Then, alpha diversity metrics (PD whole tree, Chao1 index and Simpson’s
evenness index) were computed. Statistical analyses of the alpha diversity indices were performed using GraphPad Prism 6 (GraphPad Software, Inc., La Jolla, CA, USA). The assumptions of the
t-test and ANOVA were checked before performing the analyses. An unpaired t-test (with Welch’s correction when necessary) was used to find the spatial effects (FW vs each of the SW stages).
To elucidate the temporal effects of the SW stages, one-way ANOVA followed by Tukey’s multiple comparison test was employed. Statistical significance was established at _p < 0.05_. Beta
diversity was measured using UniFrac58 and PCoA was performed on the UniFrac results. Differential abundance of the OTUs across different groups was assessed using LEfSe version 1.059 to
elucidate both the spatial and temporal differences, with the number of sequences rarefied to 20,000 per sample, the _p-value_ set at _0.05_ and an LDA log score threshold of 3.5. The
results were plotted in the form of a cladogram using GraPhlAn version 0.9.760. To predict the metagenomes of each of the samples, a closed reference (gg_13_5) OTU-picking strategy was
adopted with a 97% sequence similarity threshold using PICRUSt version 1.0.0 with the default parameters61. The accuracy of the predictions of the metagenomes was assessed by computing NSTI
(Nearest Sequenced Taxon Index), which is an index that indicates the relation of the microbes in a particular sample to the bacterial genomes in a database. The NSTI score corresponding to
the PICRUSt (Phylogenetic Investigation of Communities by Reconstruction of Unobserved States) analysis is provided in Supplementary Table S6. The associated metabolic pathways were
deciphered by employing HUMAnN (The HMP Unified Metabolic Analysis Network) version 0.99 with the default settings62. The identified pathways were analysed for statistical significance using
LEfSe with a p-value cut-off of 0.05 and an LDA log score cut-off of 2. Core OTUs that were present in at least 90% of the samples in each group (9 fish per group) were also computed using
QIIME. The number of core OTUs shared between groups was identified using VENNY version 2.0.263. The raw data could be accessed under the MG-RAST IDs: 4626776.3, 4626778.3, 4626779.3,
4626780.3, 4626781.3, 4626782.3, 4626783.3, 4626784.3, 4626785.3, 4626777.3, 4626786.3, 4626788.3, 4626789.3, 4626790.3, 4626791.3, 4626792.3, 4626793.3, 4626794.3, 4626795.3, 4626787.3,
4626796.3, 4626797.3, 4626798.3, 4626799.3, 4626800.3, 4626801.3, 4626802.3, 4626803.3, 4626804.3, 4626805.3, 4626806.3, 4626807.3, 4626808.3, 4626809.3, 4626810.3, 4626811.3, 4626812.3 and
4626813.3. ADDITIONAL INFORMATION HOW TO CITE THIS ARTICLE: Lokesh, J. and Kiron, V. Transition from freshwater to seawater reshapes the skin-associated microbiota of Atlantic salmon. _Sci.
Rep_. 6, 19707; doi: 10.1038/srep19707 (2016). REFERENCES * Marchesi, J. R. & Ravel, J. The vocabulary of microbiome research: a proposal. Microbiome 3, 31 (2015). Article PubMed
PubMed Central Google Scholar * Gomez, D., Sunyer, J. O. & Salinas, I. The mucosal immune system of fish: the evolution of tolerating commensals while fighting pathogens. Fish
Shellfish Immunol. 35, 1729–39 (2013). Article CAS PubMed PubMed Central Google Scholar * Yoshimizu, M. & Kimura, T. Study on the intestinal microflora of salmonids. Fish Pathol.
10, 243–259 (1976). Article Google Scholar * Hess, S., Wenger, A. S., Ainsworth, T. D. & Rummer, J. L. Exposure of clownfish larvae to suspended sediment levels found on the Great
Barrier Reef: Impacts on gill structure and microbiome. Sci. Rep. 5, 10561 (2015). Article ADS CAS PubMed PubMed Central Google Scholar * Folmar, L. C. & Dickhoff, W. W. The
parr-smolt transformation (smoltification) and seawater adaptation in salmonids. Aquaculture 21, 1–37 (1980). Article CAS Google Scholar * Ángeles Esteban, M. An overview of the
immunological defenses in fish skin. ISRN Immunol. 2012, 1–29 (2012). Article Google Scholar * Schmidt, V. & Smith, K. Community assembly of a euryhaline fish microbiome during
salinity acclimation. Mol. Ecol. 24, 2537–2550 (2015). Article PubMed Google Scholar * Mohammed, H. H. & Arias, C. R. Potassium permanganate elicits a shift of the external fish
microbiome and increases host susceptibility to columnaris disease. Vet. Res. 46, 82 (2015). Article PubMed PubMed Central CAS Google Scholar * Wittebolle, L. et al. Initial community
evenness favours functionality under selective stress. Nature 458, 623–6 (2009). Article ADS CAS PubMed Google Scholar * Star, B., Haverkamp, T. H. A., Jentoft, S. & Jakobsen, K. S.
Next generation sequencing shows high variation of the intestinal microbial species composition in Atlantic cod caught at a single location. BMC Microbiol. 13, 248 (2013). Article PubMed
PubMed Central CAS Google Scholar * Groudieva, T., Grote, R. & Antranikian, G. _Psychromonas arctica_ sp. nov., a novel psychrotolerant, biofilm-forming bacterium isolated from
Spitzbergen. Int. J. Syst. Evol. Microbiol. 53, 539–45 (2003). Article CAS PubMed Google Scholar * Yakimov, M. M. et al. _Oleispira antarctica_ gen. nov., sp. nov., a novel
hydrocarbonoclastic marine bacterium isolated from Antarctic coastal sea water. Int. J. Syst. Evol. Microbiol. 53, 779–85 (2003). Article CAS PubMed Google Scholar * Holmström, C. Marine
_Pseudoalteromonas_ species are associated with higher organisms and produce biologically active extracellular agents. FEMS Microbiol. Ecol. 30, 285–293 (1999). Article PubMed Google
Scholar * Yildiz, H. & Aydin, S. Pathological effects of _Arcobacter cryaerophilus_ infection in rainbow trout (_Oncorhynchus mykiss_ Walbaum). Acta Vet. Hung. 54, 191–199 (2006).
Article CAS PubMed Google Scholar * Pujalte, M. J., Sitjà-Bobadilla, A., Macián, M. C., Álvarez-Pellitero, P. & Garay, E. Occurrence and virulence of _Pseudoalteromonas_ spp. in
cultured gilthead sea bream (_Sparus aurata_) and European sea bass (_Dicentrarchus labrax_). Molecular and phenotypic characterisation of _P. undina_ strain U58. Aquaculture 271, 47–53
(2007). Article Google Scholar * Geng, Y. et al. _Stenotrophomonas maltophilia_, an emerging opportunist pathogen for cultured channel catfish, _Ictalurus punctatus_, in China. Aquaculture
308, 132–135 (2010). Article Google Scholar * Jezbera, J., Jezberová, J., Brandt, U. & Hahn, M. W. Ubiquity of _Polynucleobacter necessarius_ subspecies _asymbioticus_ results from
ecological diversification. Environ. Microbiol. 13, 922–31 (2011). Article CAS PubMed PubMed Central Google Scholar * Bowman, J. P. & Nowak, B. Salmonid gill bacteria and their
relationship to amoebic gill disease. J. Fish Dis. 27, 483–92 (2004). Article CAS PubMed Google Scholar * Heikkinen, J. et al. Effects of soybean meal based diet on growth performance,
gut histopathology and intestinal microbiota of juvenile rainbow trout (_Oncorhynchus mykiss_). Aquaculture 261, 259–268 (2006). Article CAS Google Scholar * Kormas, K. A., Meziti, A.,
Mente, E. & Frentzos, A. Dietary differences are reflected on the gut prokaryotic community structure of wild and commercially reared sea bream (_Sparus aurata_). Microbiologyopen 3,
718–28 (2014). Article CAS PubMed PubMed Central Google Scholar * Liu, Z.-P., Wang, B.-J., Liu, Y.-H. & Liu, S.-J. _Novosphingobium taihuense_ sp. nov., a novel
aromatic-compound-degrading bacterium isolated from Taihu lake, China. Int. J. Syst. Evol. Microbiol. 55, 1229–32 (2005). Article CAS PubMed Google Scholar * Nishiyama, M., Senoo, K.,
Wada, H. & Matsumoto, S. Identification of soil micro-habitats for growth, death and survival of a bacterium, γ-1,2,3,4,5,6-hexachlorocyclohexane-assimilating _Sphingomonas
paucimobilis_, by fractionation of soil. FEMS Microbiol. Ecol. 10, 145–150 (1992). Article Google Scholar * Lebuhn, M. et al. Taxonomic characterization of _Ochrobactrum_ sp. isolates from
soil samples and wheat roots and description of _Ochrobactrum tritici_ sp. nov. and _Ochrobactrum grignonense_ sp. nov. Int. J. Syst. Evol. Microbiol. 50, 2207–2223 (2000). Article CAS
PubMed Google Scholar * Ringø, E., Sperstad, S., Myklebust, R., Refstie, S. & Krogdahl, Å. Characterisation of the microbiota associated with intestine of Atlantic cod (_Gadus
morhua_). Aquaculture 261, 829–841 (2006). Article CAS Google Scholar * Lazado, C. C., Caipang, C. M. A., Rajan, B., Brinchmann, M. F. & Kiron, V. Characterization of GP21 and GP12:
two potential probiotic bacteria isolated from the gastrointestinal tract of Atlantic cod. Probiotics Antimicrob. Proteins 2, 126–134 (2010). Article PubMed Google Scholar * Rungrassamee,
W. et al. Characterization of intestinal bacteria in wild and domesticated adult black tiger shrimp (_Penaeus monodon_). PLoS One 9, e91853 (2014). Article ADS PubMed PubMed Central CAS
Google Scholar * Jensen, S., Ovreås, L., Bergh, O. & Torsvik, V. Phylogenetic analysis of bacterial communities associated with larvae of the Atlantic halibut propose succession from
a uniform normal flora. Syst. Appl. Microbiol. 27, 728–36 (2004). Article CAS PubMed Google Scholar * Shah, S. Q. A. et al. Antimicrobial resistance and antimicrobial resistance genes in
marine bacteria from salmon aquaculture and non-aquaculture sites. Environ. Microbiol. 16, 1310–1320 (2014). Article CAS PubMed Google Scholar * Song, J., Choo, Y.-J. & Cho, J.-C.
_Perlucidibaca piscinae_ gen. nov., sp. nov., a freshwater bacterium belonging to the family Moraxellaceae. Int. J. Syst. Evol. Microbiol. 58, 97–102 (2008). Article CAS PubMed Google
Scholar * Nogi, Y. in Cold-adapted Microorg. ( Yumoto, I. ) (Caister Academic Press, 2013). * Adikesavalu, H., Patra, A., Banerjee, S., Sarkar, A. & Abraham, T. J. Phenotypic and
molecular characterization and pathology of _Flectobacillus roseus_ causing flectobacillosis in captive held carp _Labeo rohita_ fingerlings. Aquaculture 439, 60–65 (2015). Article CAS
Google Scholar * Loch, T. P. & Faisal, M. Emerging flavobacterial infections in fish: A review. J. Adv. Res. 6, 283–300 (2015). Article CAS PubMed Google Scholar * Bowman, J. P.
& Nowak, B. Salmonid gill bacteria and their relationship to amoebic gill disease. J. Fish Dis. 27, 483–92 (2004). Article CAS PubMed Google Scholar * Musharrafieh, R., Tacchi, L.,
Trujeque, J., LaPatra, S. & Salinas, I. _Staphylococcus warneri_, a resident skin commensal of rainbow trout (_Oncorhynchus mykiss_) with pathobiont characteristics. Vet. Microbiol. 169,
80–8 (2014). Article PubMed Google Scholar * Kazakov, A. E. et al. Comparative genomics of regulation of fatty acid and branched-chain amino acid utilization in proteobacteria. J.
Bacteriol. 191, 52–64 (2009). Article CAS PubMed Google Scholar * Masip, L., Veeravalli, K. & Georgiou, G. The many faces of glutathione in bacteria. Antioxid. Redox Signal. 8,
753–62 (2006). Article CAS PubMed Google Scholar * Spalding, M. D. & Prigge, S. T. Lipoic acid metabolism in microbial pathogens. Microbiol. Mol. Biol. Rev. 74, 200–28 (2010).
Article CAS PubMed PubMed Central Google Scholar * Razak, A. A., Ramadan, S. E. & el-Zawahry, K. Metabolism of selenium in a selenium-dependent bacterium. Biol. Trace Elem. Res. 25,
187–92 (1990). Article CAS PubMed Google Scholar * Shimizu, H. & Hirasawa, T. in Amin. Acid Biosynth. – Pathways, Regul. Metab. Eng. ( Wendisch, V. F. ) 5 (Springer Berlin
Heidelberg, 2007). * Rodionov, D. A., Vitreschak, A. G., Mironov, A. A. & Gelfand, M. S. Comparative genomics of the methionine metabolism in Gram-positive bacteria: a variety of
regulatory systems. Nucleic Acids Res. 32, 3340–53 (2004). Article CAS PubMed PubMed Central Google Scholar * Liu, M., Prakash, C., Nauta, A., Siezen, R. J. & Francke, C.
Computational analysis of cysteine and methionine metabolism and its regulation in dairy starter and related bacteria. J. Bacteriol. 194, 3522–33 (2012). Article CAS PubMed PubMed Central
Google Scholar * van Heijenoort, J. Formation of the glycan chains in the synthesis of bacterial peptidoglycan. Glycobiology 11, 25R–36R (2001). Article CAS PubMed Google Scholar *
Scheffers, D.-J. & Pinho, M. G. Bacterial cell wall synthesis: new insights from localization studies. Microbiol. Mol. Biol. Rev. 69, 585–607 (2005). Article CAS PubMed PubMed Central
Google Scholar * Chai, Y., Beauregard, P. B., Vlamakis, H., Losick, R. & Kolter, R. Galactose metabolism plays a crucial role in biofilm formation by _Bacillus subtilis_. MBio 3,
e00184–12 (2012). Article CAS PubMed PubMed Central Google Scholar * Whitfield, C. & Trent, M. S. Biosynthesis and export of bacterial lipopolysaccharides. Annu. Rev. Biochem. 83,
99–128 (2014). Article CAS PubMed Google Scholar * Schnaitman, C. A. & Klena, J. D. Genetics of lipopolysaccharide biosynthesis in enteric bacteria. Microbiol. Rev. 57, 655–82
(1993). Article CAS PubMed PubMed Central Google Scholar * Bourquin, F., Capitani, G. & Grütter, M. G. PLP-dependent enzymes as entry and exit gates of sphingolipid metabolism.
Protein Sci. 20, 1492–508 (2011). Article CAS PubMed PubMed Central Google Scholar * An, D., Na, C., Bielawski, J., Hannun, Y. A. & Kasper, D. L. Membrane sphingolipids as essential
molecular signals for _Bacteroides_ survival in the intestine. Proc. Natl. Acad. Sci. USA 108 SUPPL, 4666–71 (2011). Article ADS CAS PubMed Google Scholar * Klindworth, A. et al.
Evaluation of general 16S ribosomal RNA gene PCR primers for classical and next-generation sequencing-based diversity studies. Nucleic Acids Res. 41, e1 (2013). Article CAS PubMed Google
Scholar * Kuczynski, J. et al. Experimental and analytical tools for studying the human microbiome. Nat. Rev. Genet. 13, 47–58 (2012). Article CAS Google Scholar * Hamady, M. &
Knight, R. Microbial community profiling for human microbiome projects: Tools, techniques and challenges. Genome Res. 19, 1141–52 (2009). Article CAS PubMed PubMed Central Google Scholar
* Caporaso, J. G. et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 7, 335–6 (2010). Article CAS PubMed PubMed Central Google Scholar * Edgar, R.
C. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nat. Methods 10, 996–8 (2013). Article CAS PubMed Google Scholar * Edgar, R. C., Haas, B. J., Clemente, J. C.,
Quince, C. & Knight, R. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 27, 2194–200 (2011). Article CAS PubMed PubMed Central Google Scholar * Edgar, R.
C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26, 2460–1 (2010). Article CAS PubMed Google Scholar * DeSantis, T. Z. et al. Greengenes, a chimera-checked
16S rRNA gene database and workbench compatible with ARB. Appl. Environ. Microbiol. 72, 5069–72 (2006). Article CAS PubMed PubMed Central ADS Google Scholar * Price, M. N., Dehal, P.
S. & Arkin, A. P. FastTree 2- approximately maximum-likelihood trees for large alignments. PLoS One 5, e9490 (2010). Article ADS PubMed PubMed Central CAS Google Scholar *
Lozupone, C. & Knight, R. UniFrac: a new phylogenetic method for comparing microbial communities. Appl. Environ. Microbiol. 71, 8228–35 (2005). Article CAS PubMed PubMed Central ADS
Google Scholar * Segata, N. et al. Metagenomic biomarker discovery and explanation. Genome Biol. 12, R60 (2011). Article PubMed PubMed Central Google Scholar * Asnicar, F., Weingart,
G., Tickle, T. L., Huttenhower, C. & Segata, N. Compact graphical representation of phylogenetic data and metadata with GraPhlAn. PeerJ 3, e1029 (2015). Article PubMed PubMed Central
Google Scholar * Langille, M. G. I. et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nat. Biotechnol. 31, 814–21 (2013). Article CAS
PubMed PubMed Central Google Scholar * Abubucker, S. et al. Metabolic reconstruction for metagenomic data and its application to the human microbiome. PLoS Comput. Biol. 8, e1002358
(2012). Article CAS PubMed PubMed Central Google Scholar * Oliveros, J. V. E. N. N. Y. . An interactive tool for comparing lists with Venn diagrams. BioinfoGP, CNB-CSIC (2007). at
http://bioinfogp.cnb.csic.es/tools/venny/index.html Download references ACKNOWLEDGEMENTS Nord University funded this study. We thank Mr. Spyros Kollias for his technical help in sequencing
the libraries. The support of Hilde Ribe, at the Research Station during the course of fish sampling is acknowledged. The efforts of the staff at Cermaq Norway AS, Hopen, Bodø are also
gratefully acknowledged. AUTHOR INFORMATION AUTHORS AND AFFILIATIONS * Faculty of Biosciences and Aquaculture, Nord University, Bodø, 8049, Nordland, Norway Jep Lokesh & Viswanath Kiron
Authors * Jep Lokesh View author publications You can also search for this author inPubMed Google Scholar * Viswanath Kiron View author publications You can also search for this author
inPubMed Google Scholar CONTRIBUTIONS V.K. conceived the project, wrote and revised the manuscript. J.L. performed the experiments, data analysis and wrote the first draft. Manuscript was
read and approved by both authors. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare no competing financial interests. ELECTRONIC SUPPLEMENTARY MATERIAL SUPPLEMENTARY INFORMATION
SUPPLEMENTARY TABLES RIGHTS AND PERMISSIONS This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are
included in the article’s Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to
obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/ Reprints and permissions ABOUT THIS
ARTICLE CITE THIS ARTICLE Lokesh, J., Kiron, V. Transition from freshwater to seawater reshapes the skin-associated microbiota of Atlantic salmon. _Sci Rep_ 6, 19707 (2016).
https://doi.org/10.1038/srep19707 Download citation * Received: 15 June 2015 * Accepted: 16 December 2015 * Published: 25 January 2016 * DOI: https://doi.org/10.1038/srep19707 SHARE THIS
ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link Sorry, a shareable link is not currently available for this article. Copy to clipboard
Provided by the Springer Nature SharedIt content-sharing initiative
Trending News
Error 404Error 404 No encontramos la página que buscas....
Mrs r fisher and others v east dunbartonshire council: 105494/2006MRS R FISHER AND OTHERS V EAST DUNBARTONSHIRE COUNCIL: 105494/2006 Employment Tribunal decision. Read the full decision ...
Here’s How Much Coffee You Should Drink Every Day To Lose WeightHome/Weight Loss/Here's How Much Coffee You Should Drink Every Day To Lose WeightWeight LossExpert-Recommended×We've con...
Stop whingeing Mr Hancock — the media has never been tamerI’ll start by being nice. Of the various ministers fielded by the government to front their daily briefings, Matt Hancoc...
Man utd news: real madrid to make alexis sanchez move on one conditionSanchez’s time at Manchester United has been a major disappointment with just four goals in 30 appearances for the club....
Latests News
Transition from freshwater to seawater reshapes the skin-associated microbiota of atlantic salmonABSTRACT Knowledge concerning shifts in microbiota is important in order to elucidate the perturbations in the mucosal b...
Transition 2001Share article...
Exploring Oklahoma’s Giant 'A Christmas Story' Leg Lamp1:34 Travel Exploring Oklahoma’s Giant 'A Christmas Story' Leg Lamp Facebook Twitter LinkedInChickasha, Oklahoma embrace...
Protein biosynthesis and oxidative phosphorylation in isolated rat liver mitochondriaAccess through your institution Buy or subscribe This is a preview of subscription content, access via your institution ...
Lead in lipstick & a tumor cell that moves by chewing out a pathMorning RoundsLead in lipstick & a tumor cell that moves by chewing out a path By Rebecca RobbinsDec. 22, 2016ReprintsRy...