Nanocomposite fibers based on cellulose acetate loaded with fullerene for cancer therapy: preparation, characterization and in-vitro evaluation

The current prevalence of cancerous diseases necessitates the exploration of materials that can effectively treat these conditions while minimizing the occurrence of adverse side effects.

This study aims to identify materials with the potential to inhibit the metastasis of cancerous diseases within the human body while concurrently serving as therapeutic agents for their

treatment. A novel approach was employed to enhance the anti-cancer properties of electrospun cellulose fibers by incorporating fullerene nanoparticles (NPs) into cellulose acetate (CA)

fibers, resulting in a composite material called Fullerene@CA. This development aimed at utilizing the anti-cancer properties of fullerenes for potential therapeutic applications. This

process has been demonstrated in vitro against various types of cancer, and it was found that Fullerene@CA nanocomposite fibers displayed robust anticancer activity. Cancer cells (Caco-2,

MDA-MB 231, and HepG-2 cells) were inhibited by 0.3 and 0.5 mg.g−1 fullerene doses by 58.62–62.87%, 47.86–56.43%, and 48.60–57.73%, respectively. The tested cancer cells shrink and lose

their spindle shape due to morphological changes. The investigation of the prepared nanocomposite reveals its impact on various genes, such as BCL2, NF-KB, p53, Bax, and p21, highlighting

the therapeutic compounds' effectiveness. The experimental results demonstrated that the incorporation of NPs into CA fibers resulted in a significant improvement in their anti-cancer

efficacy. Therefore, it is suggested that these modified fibers could be utilized as a novel therapeutic approach for the treatment and prevention of cancer metastasis.

On a global scale, cardiovascular disease stands as the leading cause of mortality. However, the treatment of cancer is progressively emerging as a formidable challenge due to its intricate

nature and limited efficacy of pharmaceutical interventions1,2. It is common for most types of malignancies to have intra-tumor heterogeneity, which is connected to disease progression and

inadequate therapy response3. The available treatment modalities for metastatic cancer include medication, surgery, and radiation; however, chemotherapy has proven to be the most effective

and efficient method in clinical practice4,5. Most cancer drugs work by inhibiting cancer cell growth, division, and reproduction chemotherapy. However, it has some disadvantages, including

severe systemic side effects, toxicity, resistance, and limited selectivity6. The medicinal inorganic chemistry field can potentially contribute to the development of innovative

pharmaceuticals. One notable example is the clinical utilization of carbonaceous nanomaterials7.

Due to their significant advantages over their free drug equivalents, nanoparticles (NPs)-based drug delivery systems (NDDSs) are becoming increasingly attractive for cancer therapy8,9,10.

The enhanced permeability and retention (EPR) effect is a widely recognized phenomenon that allows NPs ranging from 10 to 100 nm in diameter to selectively penetrate and accumulate in solid

tumors. This is due to the hyperpermeability of vascular walls and the limited drainage of lymphatic drainage in these tumors11,12. Several alternative routes have been developed to

circumvent the problems associated with standard chemotherapy13,14,15.

Graphene-based nanomaterials with distinctive inherent features include graphene oxide (GO), fullerenes, carbon nanotubes (CNTs), nanodiamonds, and graphene quantum dots (GQDs). The

physicochemical properties of this material, encompassing thermal, optical, electrical, mechanical, and structural attributes, confer upon it a distinct advantage over alternative

nanoparticles. These properties endow it with enhanced versatility, durability, and electrical conductance in relation to biological entities, thereby facilitating its utility in medical

diagnosis and treatment16,17. Fullerene, a carbonaceous nanomaterial with significant penetration into solid tumors and strong chemical reactivity, has received substantial attention in

cancer theranostics18,19. In addition, it is possible to functionalize fullerenes to give them unique physicochemical properties including biocompatibility and water solubility20,21.

Moreover, a combined application of the fullerene nanocore's photodynamic action can be employed to increase the effectiveness of chemotherapy20. It is worth mentioning that the anti-cancer

activity of fullerene, along with its sensitization effect on cancer cells, renders it a potent antineoplastic agent. Moreover, it can be used also as an antioxidant and a free radical

scavenger22. Consequently, numerous researchers used fullerenes as an efficient targeted anti-cancer delivery system. For instance, prostate cancer cells (PC3 cells) were targeted using

Docetaxel-loaded polyethyleneimine fullerene with a folic acid-passivated surface23. In contrast, doxorubicin (DOX) conjugation with C60 fullerene was reported as an effective treatment

against different kinds of cell lines such as Human colon adenocarcinoma cell line (HCT116) and Human Breast cancer cell line (MCF7)24. Furthermore, a cationic fullerene based siRNA

nanocomplex was used for effective inhalation of T&P&siPD-L1 which could inhibit the growth of metastatic lung cancer without apparent adverse effects and toxicity25.

Nanofibers are frequently utilized as carriers for loading bioactive compounds, particularly those that exhibit low water solubility26,27. The development of nanofibers represents a

remarkable breakthrough in the field of nanotechnology, particularly in enhancing the efficacy of the mass transport of nanotechnology28. The advantages of cellulose acetate (CA) over other

polymeric fibers are numerous. These advantages include biocompatibility, insolubility in water, biodegradability, exceptional mechanical properties, relatively low manufacturing costs, high

affinity, and excellent chemical resistance. CA is particularly suitable for usage in drug delivery systems due to its unique hydrophilicity properties24. Several applications of CA have

been reported in the literature, including affinity membranes, antimicrobial membranes, biomedical nanocomposites, filament-forming matrices, and biomedical separation28,29,30.

Pharmacological combination approaches have garnered significant attention in order to enhance treatment efficacy and mitigate the occurrence of side effects31,32. Combination chemotherapy

refers to the concurrent administration of multiple drugs that have distinct mechanisms of action and side effect profiles in order to address multidrug resistance. Nevertheless, the

implementation of combination therapy can effectively mitigate the adverse effects associated with single-drug therapy by targeting multiple signaling pathways33,34. Clinical practice has

also shown synergistic benefits higher than the sum of individual medication effects, as well as decreased systemic toxicity associated with administering lower drug dosages35.

Furthermore, encapsulation serves as an effective strategy for reducing the toxicity of materials while preserving their functionality, rendering it a viable technique in the field of

biomedical applications36. The containment of toxic substances within a shielding enclosure can substantially mitigate the potential deleterious effects on living organisms. This holds

significant importance within the realm of biomedicine, wherein the paramount considerations revolve around the safety and efficacy of materials. The process of encapsulation serves to

effectively isolate toxic components, preventing their interaction with adjacent tissues or organs, thereby reducing the potential for minimizing any adverse effects37. Additionally, the

encapsulated materials retain their activity, allowing for their intended use in biomedical applications. Whether it is drug delivery systems or implantable medical devices, encapsulation

offers a safe and efficient means of utilizing potentially toxic materials in the field of biomedicine, thereby advancing the progress of medical research and improving patient care.

Fullerene, a toxic substance with limited clinical applications, is being investigated for encapsulation in order to mitigate its toxicity. This study represents a novel approach in the

field of biomedical applications, as it is the first instance of successfully encapsulating fullerene with a safe dosage through the utilization of electrospinning.

A cyclin protein called Cyclin D regulates the progression of a cell's cycle. The creation of cyclin D, which starts during the G1 phase, drives the transition from G1 to the S phase38,39.

Cyclin D is one of the most significant cyclins ever produced in terms of functional importance. Four Cdks -Cdk2, 4, 5, and 6- are involved in its interactions40,41. In proliferating cells,

the accumulation of the cyclin D-Cdk4/6 complex is essential for the progression of the cell cycle. The D-Cdk4/6 cyclin complex partially phosphorylates retinoblastoma tumor suppressor

protein, and its inactivation may result in the expression of numerous genes necessary for S phase progression42.

This research aims to develop a potential anticancer treatment that targets cancer stem cells while causing less damage in normal cells by using novel nanocomposite electrospun fiber

consisting of fullerene NPs prepared from thermal catalytic cracking of mineral water waste bottles then loaded into CA nanofiber and its selective toxicity was tested in vitro using

different cancer cell (Caco-2, MDA-MB 231 and HepG-2 cells).

Thermo Fisher Scientific provided CA (average Mw = 4 kDa, 39.8 wt percent acetyl) (Waltham, Massachusetts, USA), dichloromethane, and acetic acid from (Sigma in St. Louis, Missouri).

Dimethyl sulfoxide (DMSO) was purchased from Merck (Germany). Dulbecco's Modified Eagle's Medium (DMEM) media were purchased from Lonza (USA), while fetal bovine serum (FBS) was purchased

from GIBCO Company (USA). In addition, 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) was purchased from Sigma Aldrich (Germany). SYBR-green PCR assay kit, cDNA

synthesis kit, and Gene JET RNA purification kit were purchased from Thermo Fisher Scientific (Waltham, Massachusetts, USA). Without additional purification, all compounds were of analytical

quality and were utilized.

Many experiments with dichloromethane and acetic acid were carried out to determine the optimal concentration of acetic acid to produce bead-free fibers. Finally, CA (10%) in acetic acid:

dichloromethane (1:1) might produce smooth and bead-free fibers. Subsequently, Fullerene@CA fiber was made using different concentrations of fullerene (0.1, 0.3, and 0.5) mg produced by

thermal catalytic cracking of mineral water waste bottles43,44 to one gram of polymer.

The nanocomposite fibers were prepared using an electrospinning apparatus consisting of a flow rate machine, a metal plate (used as a collector), and a high voltage source. Fibers were

gathered (coated with aluminum foil) using a collector. The experimental conditions encompassed a spinning flow rate of 3 ml/h, a spinning voltage of 17 kV, a receiving collector distance of

20 cm, and the experiments were conducted at room temperature. Following the completion of the electrospinning process, the electrospun Fullerene@CA nanocomposite fiber was subjected to a

vacuum oven at ambient temperature for a duration of 24 h in order to remove any residual solvent.

The surface morphology of all the electrospun Fullerene@CA nanocomposite fibers was observed using Transmission Electron Microscope (TEM, JEOLJEM 1230, Japan) and Scanning Electron

Microscopy (SEM, JEOL JSM, Japan) after coating with gold. The softwarImage-Pro 6.0 image analysis software was used to measure the diameter of each sample, and the average value was

calculated from randomly selected about 60 measurements. FTIR spectra were captured using the Shimadzu FTIR-8400 S (Japan) instrument from 4000 to 400 cm−1 wavelength with a 4 cm−1

resolution for all spectra.

The optimal excitation and emission wavelengths of free fullerene were determined through spectrofluorometry, employing a broad range of measurements, using spectrofluorometry (BMG Labtech,

Germany). Then, the release rate of fullerene from the fullerene@CA nanofiber scaffold was assessed after 6, 24, 48, and 72 h incubations in phenol red free-culture medium via measuring it

at excitation of 355 nm and emission of 590 nm.

Normal human lung fibroblast Wi-38 cell line (passage#30) was used to detect cytotoxicity of the prepared Fullerene@CA nanocomposite fibers, supplied from the American type culture

collection (ATCC, USA). Wi-38 cell line was cultured in DMEM medium 10% fetal bovine serum (FBS), seeded as 5 × 103 cells per well in a 96-well cell culture plate, and incubated at 37 °C in

a 5% CO2 incubator. After 24 h for cell attachment, 0.1, 0.3 and 0.5 mg of free-fullerene and Fullerene@CA nanocomposite fibers were incubated with Wi-38 cells for 72 h. Cell viability was

assayed by the MTT method. The wells were filled with 20 μl with 5 mg/ml MTT (Sigma, USA), and the plate was then incubated at 37 °C for 3 h. 100 μl of DMSO was added after the MTT solution

was eliminated, and a microplate reader was used to measure each well's absorbance at 570 nm (BMG LabTech, Germany). The Graphpad Instat program calculated the investigated substances'

effective, safe concentration (EC100) value (at 100% cell viability).

The anticancer effect of Fullerene@CA nanocomposite fibers was assayed using three human cancer cell lines that were obtained from (ATCC, USA). Colon cancer cell line (Caco-2, passage#32),

triple-negative breast cancer cell line (MDA-MB 231, passage#35), and liver cancer cell line (HepG-2, passage#40) were cultured in DMEM (Lonza, USA) contained with 10% FBS (GEBCO, USA)

supplemented with 10% FBS. All cancer cells (4 × 103 cells/well) were seeded in sterile 96-well plates. After 24 h, 0.1, 0.3, and 0.5 mg.g−1 Fullerene@CA and CA free-fullerene were incubated

with three cancer cell lines for 72 h at 37 °C in a 5% CO2 incubator. The MTT method was done as described above. The percentage of growth inhibition of three tested cancer cell lines was

calculated at each corresponding dose, relative to the untreated cells. Furthermore, cellular morphological changes before and after treatment with the most effective and safest anticancer

compounds were investigated using a phase contrast inverted microscope with a digital camera (Olympus, Japan).

The tested samples CA, Fullerene@CA nanocomposite fibers were incubated, for 72 h, with a Caco-2 cell line. Both untreated and treated cells were trypsinized before being incubated with

annexin V/PI for 15 min. Quantification of annexin-stained apoptotic cells utilizing the FITC signal detector (FL1) versus the phycoerythrin emission signal detector was used to investigate

the apoptosis-dependent anticancer impact (FL2).

The Gene JET RNA Purification Kit recovered total RNAs from Caco-2 cells treated with the studied anti-cancer drugs and left untreated (Thermo Scientific, USA). The mRNA was converted into

cDNA (Thermo Scientific, USA) using a cDNA Synthesis Kit. SYBR green master mix was used for real-time PCR. The used primers (Forward/Reverse) were

5′-CTGGTGGACAACATCGCCCT-3′/5′-TCTTCAGAGACAGCCAGGAGAAAT-3′, 5′-TACTCTGGCGCAGAAATTAGGTC-3′/5′-CTGTCTCGGAGCTCGTCTATTTG-3′, 5′-TAACAGTTCCTGCATGGGCGGC-3′/5′-AGGACAGGCACAAACACGCACC-3′,

5′-CCGCCGTGGACACAGAC-3′/5′-CAGAAAACATGTCAGCTGCCA-3′, and 5′-CTGGGGATGTCCGTCAGAAC-3′/5′-GCCATTAGCGCATCACAGT-3′ for BCL2, NF-KB, and p53, Bax and p21 genes, respectively. B-actin (F:

AAGCAGGAGTATGACGAGTCCG; R: GCCTTCATACATCTCAAGTTGG). The 2−ΔΔCT equation was used to estimate the change in gene expressions in the treated cancer cells relative to untreated cancer cells

using housekeeping gene B-actin.

The data are expressed as mean ± standard error of the mean (SEM) and the significant values were considered at p