Tumor invasion in draining lymph nodes is associated with treg accumulation in breast cancer patients
Tumor invasion in draining lymph nodes is associated with treg accumulation in breast cancer patients"
- Select a language for the TTS:
- UK English Female
- UK English Male
- US English Female
- US English Male
- Australian Female
- Australian Male
- Language selected: (auto detect) - EN
Play all audios:
ABSTRACT Tumor-draining lymph node (TDLN) invasion by metastatic cells in breast cancer correlates with poor prognosis and is associated with local immunosuppression, which can be partly
mediated by regulatory T cells (Tregs). Here, we study Tregs from matched tumor-invaded and non-invaded TDLNs, and breast tumors. We observe that Treg frequencies increase with nodal
invasion, and that Tregs express higher levels of co-inhibitory/stimulatory receptors than effector cells. Also, while Tregs show conserved suppressive function in TDLN and tumor,
conventional T cells (Tconvs) in TDLNs proliferate and produce Th1-inflammatory cytokines, but are dysfunctional in the tumor. We describe a common transcriptomic signature shared by Tregs
from tumors and nodes, including CD80, which is significantly associated with poor patient survival. TCR RNA-sequencing analysis indicates trafficking between TDLNs and tumors and ongoing
Tconv/Treg conversion. Overall, TDLN Tregs are functional and express a distinct pattern of druggable co-receptors, highlighting their potential as targets for cancer immunotherapy. SIMILAR
CONTENT BEING VIEWED BY OTHERS COMMON CLONAL ORIGIN OF CONVENTIONAL T CELLS AND INDUCED REGULATORY T CELLS IN BREAST CANCER PATIENTS Article Open access 18 February 2021 SPATIAL
IMMUNOPHENOTYPES PREDICT RESPONSE TO ANTI-PD1 TREATMENT AND CAPTURE DISTINCT PATHS OF T CELL EVASION IN TRIPLE NEGATIVE BREAST CANCER Article Open access 27 September 2021 SINGLE CELL
PROFILING OF PRIMARY AND PAIRED METASTATIC LYMPH NODE TUMORS IN BREAST CANCER PATIENTS Article Open access 10 November 2022 INTRODUCTION In human breast cancer, regional LNs are frequently
the first site of metastasis. From a clinical standpoint, the tumor invasion of tumor-draining LNs (TDLNs) is an important step in disease progression, and is a prognostic indicator of the
risk of recurrence and of poor survival1,2,3. However, recent clinical trials in breast cancer indicate that LN resection does not increase the patients’ overall survival4,5. From an
immunologic standpoint, little is known about the consequences of tumor metastasis on the LN’s immune functions. However, it is clear that tumors develop a broad array of immunosuppressant
mechanisms. This fact raises the question of whether the invasion of TDLNs during tumor spreading produces an accumulation of immunosuppressive cells—like FOXP3+ CD4+ regulatory T cells
(Tregs)—and imparts a tolerogenic microenvironment1,2,6,7. At present, most of our knowledge of the immune status of breast cancer patients comes from the analysis of primary tumor and blood
samples, whereas data on the immune characteristics of TDLNs are scarce8,9,10,11. Tregs expressing the transcription factor Foxp3 maintain self-tolerance and homeostasis of immune system
but also limit sterilizing immunity and dampen antitumor immunity12,13. In breast cancer increased numbers of tumor-infiltrating Tregs correlate with reduced survival12,14,15. The balance
between Tregs and Tconvs largely defines the outcome of the immune response. Tregs are highly heterogenous; they can arise in the thymus or can emerge in the periphery from Tconvs.
Furthermore, upon activation, Tregs can acquire different phenotypes, associated to different functions. Thus, based on the expression of some chemokine receptors and transcription factors,
Tregs, similar to T helper cells (Th) can be further classified in Tr1, Tr2, Tr17, Tfr13,16,17. Only a few studies have analyzed the phenotype8,12 and function of the Tregs present in the
TDLNs of patients with breast cancer18, and the available data suggest that high frequencies of total CD4+ T cells and low frequencies of Tregs18,19,20 are associated with a good prognosis.
However, a comprehensive global analysis of the phenotype and function of Tregs in tumor-invaded (I) TDLNs, non-invaded (NI) TDLNs, and primary luminal breast cancer tumors (T) is still
missing. The immunotherapeutic blockade of immune checkpoints, such as PD-1/PD-L1 and CTLA-4, has given impressive clinical results and manageable safety profiles in various tumor types21,
22. In patients with breast cancer, one of the most encouraging immunotherapies is anti-PD-1/PD-L1 monotherapy; it achieves an objective response rate of between 12 and 21%23. However, a
CTLA-4-blocking antibody has shown only limited clinical benefit24. The expression pattern of immune checkpoints of Tregs and Tconvs in luminal breast cancer has been poorly studied12,25.
Thus, considering that checkpoint-blocking antibodies can act not only during the effector T-cell phase in the tumor bed26, but also during T-cell priming in the TDLNs, it is important to
understand the immune status of the T cells (including Tregs), that can also be targeted by these antibodies. In the present study, we use high-dimensional flow cytometry, functional assays,
T-cell receptor (TCR) repertoire analysis, and RNA sequencing to characterize the immune phenotype, function and dynamics of Tregs present in paired I and NI TDLNs, and tumor; and
identified CD80-expressing Tregs as a subset of Tregs associated with bad prognosis in breast cancer patients. These data bring insights into the immunomodulatory mechanisms associated to
the presence of the tumor, and should be instrumental to guide the rationalized design of improved immunotherapies. RESULTS “BONA FIDE” MEMORY TREG CELLS ACCUMULATE IN METASTATIC TDLNS We
characterized and compared the immune profile of Tregs from paired NI and I TDLNs from patients with breast cancer. As reference, we also analyzed the Tconvs present in the primary tumor,
which have already been partly characterized12,25,27. To this end, we immune profiled freshly resected NI and I TDLNs and primary tumors from patients with luminal breast cancer having
undergone standard-of-care surgical resection (Fig. 1a). The patients’ clinical and pathological data are summarized in Supplementary Table 1. TDLNs were classified as NI or I, based on the
absence or presence of metastatic tumor cells (identified as EPCAM+ and CD45−). The flow cytometry results were confirmed by pathologic assessment (Fig. 1b, c). We evaluated the overall
distribution of the different immune cell populations in the three tissues. Using an unsupervised data analysis (see methods), we identified eight main clusters, including B cells, Tconvs,
Tregs, CD8+ T cells, no CD4+ CD8+ T cells, fibroblast/endothelial cells, tumor cells, and other leukocytes (Fig. 1d, e and Supplementary Fig. 1b). All clusters were subsequently confirmed by
manual gating (Supplementary Fig. 1b–c). Quantification of the different populations (Supplementary Fig. 1d–f and Supplementary Table 2) indicated that the only population that
significantly changed between NI and I TDLNs was the Tregs (Fig. 1f). Although there is some heterogeneity within samples, for 10 out of 14 patients the proportion of Tregs among total CD45+
T cells was higher in the I TDLN, compared with the NI one (_p_ < 0.05). Also, we observed that in the primary tumor, Tregs constitute an important proportion of the whole T-cell
infiltrate, reaching up to 19% of CD45+ cells. We next analyzed the impact of nodal metastasis on the naïve/memory phenotype of Tregs in the TDLNs. As reported by Sakaguchi and
colleagues28,29, Tregs and Tconvs can be classified based on the expression of CD45RA and FOXP3 as: (I) naive Tregs, (II) effector Tregs (Eff Treg), (III) FOXP3+ non-Tregs (recently
activated Tconvs), (IV) memory Tconvs, and (V) naive Tconvs (Fig. 2a). We observed that I TDLNs contained higher frequencies of Eff Tregs (_p_ < 0.01), and lower proportions of naive
Tconvs (_p_ < 0.05) than NI TDLNs, for most of the patients studied. In the tumor, the CD4+ T-cell compartment was characterized by very low proportions of naive cells and relatively high
proportions of Eff Tregs and memory Tconvs12,30. These results let us hypothesize that tumor cells in the TDLNs (i) may be recognized by naive Tregs/Tconvs, which then acquire an Eff Treg
phenotype; and/or (ii) may be involved in the accumulation of Eff Tregs that circulate from the tumor to the TDLNs. TREGS IN TDLNS SHOW DISTINCT IMMUNE CHECKPOINT MOLECULES Little
information exists on the pattern of expression of druggable immune checkpoint molecules on Tregs from TDLNs and tumor of patients with breast cancer12,25. Given that immune checkpoint
molecules were barely detected in naive T cells (Supplementary Fig. 2a), we performed their analysis on the memory T-cell compartment. Among the Tregs of the three tissues, a very high
frequency expressed the co-inhibitory receptors PD-1 and CTLA-4 (Supplementary Fig. 2a–c) and the costimulatory receptors ICOS and GITR (Fig. 2d and Supplementary Fig. 2c); and a lower
fraction expressed OX40 (Fig. Supplementary Fig. 2c). Invasion of TDLNs correlated with higher frequencies of Tregs expressing ICOS, GITR, OX40, and PD-1, increased frequencies of Tregs with
double expression of PD-1 and ICOS (PD-1+ ICOS+ Tregs) (accompanied by a decrease in the PD-1-ICOS− Tregs) (Fig. 2e), and no significant difference for CTLA-4 expression (always very high)
(Fig. 2b–d and Supplementary Fig. 2c). In the tumor, even higher frequencies of Tregs expressing each of the measured checkpoints were observed (Fig. 2b–d and Supplementary Fig. 2c). These
results suggest that in the presence of tumor cells, higher proportion of Tregs get activated and express immune checkpoints, and underscore that antibodies targeting these molecules could
act not only during the effector phase in the tumor, but also during priming, in the TDLNs. As T-cell subsets with opposed immune function can be modulated by therapeutic Abs with agonistic,
antagonistic, or depleting functions, it is of interest to understand the differential expression of positive and negative immune checkpoints on effector Tconvs and CD8+ T cells, and on
suppressive Tregs (Supplementary Fig. 2A and 3). At all sites, Tregs were the most prevalent T-cell subset population expressing costimulatory (ICOS, GITR, and OX40) and co-inhibitory (PD-1,
CTLA-4) immune checkpoint molecules (Fig. 2b–e and Supplementary Fig. 2c–e). Also, Tregs showed the highest mean fluorescence intensities (MFIs) values for ICOS, OX40, GITR, CTLA-4, and
PD-1 (Supplementary Fig. 2a). Tregs also expressed the highest levels other Treg cell-associated molecules, such as Ki-67, HELIOS, CD25, and CD39 (Supplementary Fig. 2a–b), which could
represent additional druggable targets. The higher CD39 expression in tumor and I LN Tregs than the NI LN counterparts (Supplementary Fig. 2b), indicates that the presence of tumor cells
triggers the activation of Tregs and imprints a potential higher suppressive function. TREGS IN TDLN AND TUMOR HAVE CONSERVED SUPPRESSIVE FUNCTION Tregs can show an unstable phenotype and
lose their suppressive function in pro-inflammatory microenvironments31,32. We evaluated whether NI, I TDLNs and tumor, represent pro- or antiinflammatory microenvironments in which Tregs
exert their functions. Ex vivo whole-cell suspensions from the three tissues were stimulated and T-cell proliferation was analyzed. As shown in Fig. 3a, Tconvs from NI and I TDLNs highly
proliferated; however, Tconvs from the tumor stopped dividing after a few cycles. Upon phorbol 12-myristate 13-acetate (PMA)-ionomycin stimulation, the frequency of IFN-γ+ Tconvs was
significantly higher in I versus NI TDLNs (Fig. 3b), and only a small fraction of all the T cell produced IL-17A. To assess whether Tregs from I TDLN -where Tconvs are more pro-inflammatory-
maintain their suppressive function, we performed classical suppression tests. Tregs from both I TDLNs and the tumor had similarly proficient suppressor functions (Fig. 3c). Overall, these
results indicate that: (i) Tregs from both TDLNs and the tumor had conserved ex vivo suppressor functions, and (ii) that although Tconvs from I TDLNs readily produce pro-inflammatory
cytokines, the Tregs there do not, indicating that they did not acquire pro-inflammatory function in invaded breast cancer LNs. I TDLNS SHOW HIGHER PROPORTIONS OF TR1 AND TFR CELLS Published
transcriptomic signatures of Tregs from different tissues indicate that Tregs constitute a heterogeneous population shaped by microenvironmental cues12,25,33. Indeed, the role of cytokines
and chemokines present in the microenvironment influences the terminal differentiation of tumor-specific Tconvs with different polarization patterns, functional specialization, and migration
capacities. In addition, mouse studies have suggested that Tregs may also co-opt transcriptional programs adapted to regulate Th1, Th2, or Th17 responses13,16,17. To assess the functional
diversity of Tconvs and Tregs present in both I and NI TDLNs, we analyzed CD4+ T-cell chemokine receptors pattern (as described in16,34). We first evaluated the phenotype of Tconvs (CD4+
CD127+ CD25−) as Th1 (CXCR3+), Th2 (CXCR3−CCR6−CCR4+), Th17 (CXCR3−CCR6+CCR4+CCR10−), Th22 (CXCR3−CCR6+CCR4+CCR10+), and T follicular helper cells (Tfh, PD-1highCXCR5+) (Fig. 4a). Among
Tconvs (Fig. 4b), Th1 cells were the most abundant population. Compared with NI TDLNs, I ones showed higher proportions of Th1 (_p_ < 0.01) and Tfh cells (_p_ < 0.05), and lower
proportions of Th22 cells (_p_ < 0.05). Around 10% of Tconvs were Th2 cells (with no differences between NI and I TDLNs) and very few of them expressed CRTh2, a marker of a subset of
lineage-committed Th2 cells34. Finally, Th17 cell proportions were similar in NI and I TDLNs (Fig. 4b). We observed that Tregs from TDLNs followed a similar chemokine receptor pattern as
Tconvs. And also, similar to Tconvs, compared with NI TDLNs, in I TDLNs there were significant higher proportions of Th1-like Tregs (_p_ < 0.05), Th22-like Tregs (_p_ < 0.05) and
Tfh-like Tregs (Tfr) (_p_ < 0.05), respectively. Similar frequencies of Th2-like Tregs and Th17-like Tregs were found in NI and I TDLNs (Fig. 4c). The strikingly similar pattern of helper
Tconv and helper-like Treg phenotype was reflected by a strong positive correlation of the frequencies of Th1 vs Th1-like (_r_2 = 0.23; _p_ = 0.008), Th2 vs Th2-like (_r_2 = 0.36; _p_ =
0.0005), Th22 vs Th22-like (_r_2 = 0.41; _p_ = 0.007), and Tfh vs Tfr (_r_2 = 0.92; _p_ < 0.0001) populations; but not of Th17 vs Th17-like (_r_2 = 0.08; _p_ = 0.23) (Fig. 4d). The
permeabilization step required for FOXP3 staining is not compatible with labeling of chemokine receptors, except for CXCR3 and CCR4. We further studied the expression of these two receptors
in the CD4+ T-cell subsets as described in Fig. 2a. We observed that the frequency of CXCR3+ cells was significantly increased among Eff Tregs (57.9% vs 67.5%, _P_ < 0.01), FOXP3+
non-Tregs (38.9% vs 47%, _P_ < 0.01) and memory Tconvs (42.3% vs 53.5%, _P_ < 0.01) from the I compared with NI TDLNs (Supplementary Fig. 4a) and we observed similar frequencies of
CCR4+ CD4+ T-cell subpopulations in I vs NI TDLNs (Supplementary Fig. 4b). We analyzed the expression of T-bet and GATA3, two canonical molecules associated with Th1-like and Th2-like
functions, respectively (Supplementary Fig. 4c–d). In I TDLNs we observed the frequency of T-bet+ Tregs was higher and the frequency of GATA3+ Tregs was lower compared with NI TDLNs. These
results suggest that nodal invasion by the tumor induces a Th1-biased phenotype of Treg cells, and point to a shared migrational imprinting program with effector (Th1) Tconvs, like
previously described16,34. In all, Tconvs and Tregs from TDLNs follow similar phenotypic and functional specific programs, reinforcing the concept that the ability of Tregs to maintain local
immune homeostasis depends on their appropriate colocalization with Tconvs. TREGS WITH SHARED TCRS ARE FOUND IN TDLNS AND TUMORS The TCR repertoire has been used to explore the clonal
diversity and trafficking patterns among TDLNs and tumor of total T cells35. To go deeper in CD4+ T cells subsets, we performed high-throughput sequencing of the TCR-β CDR3s of Tregs
(CD25highCD45RA−) and Tconvs (CD25−CD45RA−) (see methods) obtained from the NI and I TDLNs for five patients and from primary tumors for three of these patients (the distribution of the
sequenced TCR-β CDR3s for the entire set of samples are summarized in Supplementary Table 3). The cumulative frequency of TCR-β CDR3s in each sample (Fig. 5a, c and Supplementary Fig. 5a and
5c–d), indicates that Tregs were more clonally expanded than Tconvs in all tissues; and that the TCR repertoire of Tregs and Tconvs were less diverse in the tumor than in the TDLNs,
suggesting an accumulation of tumor-specific CD4+ T cells in the tumor. Next, to analyze the TCR repertoire overlap among the three different tissues, for two patients we could identify the
top 100 most expanded CDR3s of the Tregs or Tconvs present in the tumor (likely enriched in tumor-specific clones) and study their distribution in the NI and I TDLNs (Fig. 5b, d and
Supplementary Fig. 5b). For Tconvs in each patient, 10.5% and 4.5% out of the 100 top tumor clones were found in the I TDLNs, and 1% and 3.4% of the 100 top tumor clones were observed in the
NI TDLN (Fig. 5b). For Tregs, 1.9% and 17.5% of the top 100 tumor clones were observed in the I TDLN and 2.6% and 1.6% of the 100 top tumor clones were observed in the NI TDLN (Fig. 5d).
These results suggest that tumor-specific Tconvs and Tregs clones recirculate between the tumor and the TDLNs. Tumor-specific Tregs can originate in the thymus (tTreg) or they can arise from
conversion of Tconvs into “peripheral-induced” Treg, (pTreg)36,37. Peripheral Treg induction in TDLNs has been demonstrated in mouse models38 but it has been poorly studied in humans12,25.
To assess the pTregs presence, we evaluated the TCR repertoire overlap between Tregs and Tconvs. This analysis revealed that Tconvs and Tregs with shared TCRs were present within every
tissue, with a mean of 17.6% of the total Treg TCRs shared with the Tconvs in NI TDLNs, 14.3% in I TDLNs, and 21.7% in tumors (Fig. 5e and Supplementary Table 4). Moreover, tumor-Treg
clonotypes were shared in an inter-tissue fashion with Tconvs, as 16.9% and 21.9% of the tumor-Treg clonotypes were also found within Tconvs present in NI and I TDLNs, respectively (Fig.
5f). These data uncover that a sizable proportion of Tregs in breast tumors are pTregs; however, do not allow concluding whether conversion occurs in one given organ or whether pTregs
recirculate among the TDLNs and the tumor. TREGS FROM I TDLNS DISPLAY UNIQUE TRANSCRIPTOMIC FEATURES We performed RNA sequencing of bulk sorted Tregs and Tconvs obtained from matched NI, I
TDLNs, and tumors (see methods). We observed 2985, 868, and 1800 differentially expressed genes (DEGs, fold change 1.2, _p_ < 0.05) between Tregs and Tconvs in NI TDLNs, I TDLNs, and
tumors, respectively (Fig. 6a, Supplementary Data 1). Pathway analysis of these three lists of DEGs identified a series of canonical biological pathways (Fig. 6b and Supplementary Data 2).
Among the top five canonical pathways, NI and I TDLNs shared Th1 and Th2 activation/polarization pathways and the “T-cell exhaustion signaling pathway”, indicating chronic activation and
polarization as main characteristics of the CD4+ T cells in TDLNs. Differently, tumor CD4+ T cells were principally associated with translational regulation (“Regulation of eIF4 and p70S6K
Signaling” pathway), activation of the Inositol phosphate pathway, and signaling mediated by glucorticoids; highlighting intrinsic differences with the lymph node residing cells. Then, we
studied the molecular features shared by Treg and Tconv (“common signature”) analyzing the DEGs common between Tregs and Tconvs from all tissues; and to investigate tissue adaptation, we
used the lists of DEGs uniquely expressed by Tregs or Tconvs of each tissue. The “common Treg signature” consisted of 121 genes (commonly upregulated in the Treg/Tconv comparison of the
three tissues, “UUU” genes in the Venn diagram of Fig. 6a), included _FOXP3, IL2RA, TNFRSF9, TNFRSF1B_, and _ENTPD1_ (Fig. 6c), and was significantly associated with “Regulatory T cells” and
“IL-2 signaling pathways” as well as “TNFR2 signaling pathway” (EnrichR, #1, Supplementary Data 3). The “common Tconv signature” was defined by 70 genes (“DDD” genes) including _IL7R,
CD40LG,_ and _IL2_ (Fig. 6c), and was significantly associated with “CD4+ T cells”, “FAS signaling pathway” as well as “TRAIL signaling pathway” Fig. 6c (EnrichR, #2, Supplementary Data 3).
Analysis of molecular signatures associated to each tissue revealed specific programs: (I) Tregs from NI TDLN were characterized by 965 genes (“U” genes), contributing to the “Antigen
processing and presentation of exogenous peptide” and “DNA replication” (EnrichR #3, Supplementary Data 3), reflecting basal replication of Tregs in the LNs; (II) Tregs from I TDLN were
characterized by barely 153 genes (“U” genes), associated to the biological pathways: “apoptosis”, “IL-12-mediated signaling events”, and Type III IFN signaling (EnrichR #4, Supplementary
Data 3), likely reflecting Treg expansion and contraction in response to the local production of pro-inflammatory signals like IL-12 and IFNs; (iii) tumor Tregs uniquely displayed 465 genes
(“U” genes) participating to a heterogeneous transcriptomic program comprising the pathways “Oxidative phosphorylation”, “TNFR2 signaling”, and “4-1BB signaling” (EnrichR #5, Supplementary
Data 3), pointing out to a differential metabolic state in the tumor and signaling through TNFR2 and 4-1BB, previously associated to activated Tregs in the tumor39,40. Of note, tumor Tregs
highly expressed _IL1RL1_ and _IL1RN,_ which have been associated to inhibition of IL-1-mediated inflammation41,42. These results suggest that Tregs from the tumor and the TDLNs express a
common gene signature, but also exhibit distinct transcriptional cell fates underlying tissue-specific adaptation. Fig. 6c, d shows the expression levels of characteristic markers of Tconvs
and Tregs cells selected by their influence on T-cell migration, function, or target potential. For example, _CCR8_ is characteristic of Tregs across tissues (as previously described12), but
other cell adhesion molecules and chemokine receptors are differentially associated to Tregs and Tconvs from the different tissues (Fig. 6d). In more detail, _SIGLEC17P_ expression could be
used by Tregs to circulate among all tissues; _CD33, PCDH1, JAM2, CDHR3,_ and _ITGA3_ would orchestrate migration/retention in NI TDLNs; _CADM1_ in I TDLNS; and _CEACAM6_ in tumor. Of note,
_CEACAM6_ expressed by tumor Tregs, has been associated with cancer progression43. Also, Tregs from NI ad I TDLN share _CD58, ITGAM, MCAM, CEACAM4, SELPLG,_ and _HMMR_ expression, which
could ensure recirculation among TDNLs; and Tregs from I TDLN and tumor Tregs share _ICAM1_ expression, which could be responsible for the migration among tissues with presence of tumor
cells. Finally, Tconvs from the tumor differentially expressed higher levels of _IGAL_ (LFA-1) than Tregs. These results underlie that different molecular cues attract and retain the Treg
and Tconv cells to the TDLNs or to the tumor. CD80-EXPRESSING TUMOR TREGS CORRELATE WITH BAD PROGNOSIS To evaluate the clinical relevance of DEGs highly expressed in Tregs from TDLNs and
tumors (Fig. 6a) we investigated the impact of these genes on tumor recurrence and survival using the breast cancer archive from the Cancer Genome Atlas (TCGA-BRCA, see methods). We first
assessed _FOXP3_ gene; the master transcription factor of Tregs, and observed that _FOXP3_ mRNA expression level per se has no impact in overall survival (OS) and disease free-survival
(DFS), as previously described12 (Supplementary Fig. 6a–b). To identify genes which expression correlated with _FOXP3_ across the TCGA-BRCA cohort, we calculated the gene:_FOXP3_ mRNA ratio
for all DEGs (see methods). We found 10 genes, in which mRNA levels were positively correlated with _FOXP3_ reads (_r_ > 0.5) and high mRNA:_FOXP3_ ratios were associated with better OS
and DFS, being _CD79A_ and _TNFRSF13B_, two molecules associated with B-cell activation41, the most significantly correlated ones (Fig. 7a–d and Supplementary Fig. 6c). Furthermore, we found
a signature of three genes, namely _CD80_, _CCR8,_ and _HAVCR2_, which positively correlated with _FOXP3_ reads (Supplementary Fig. 6d) and which high mRNA:_FOXP3_ ratios were significantly
associated with poor OS (_p_ = 0,012) and DFS (_p_ = 0.01) (Fig. 7e, f). When considering these three genes independently, only the _CD80:FOXP3_ mRNA high ratio was significantly associated
with a worse OS and DFS (Fig. 7g, h). We confirmed the high expression of _CD80_ on tumor Tregs at the protein level by FACS (Fig. 7i and Supplementary Fig. 6g), but not in the I-TDLN
because of the high variability among patients (Supplementary Fig. 6e). We found that tumor Tregs showed a higher frequency and MFI of CD80 than Tconv and peripheral Tregs from healthy
donors (HD) (Fig. 7j). Of note, we detected CD80 expression in Tregs, both at the mRNA (RNA sequencing) and at the protein level (fluorescence-activated cell sorting (FACS)); as CD80 can be
acquired by Tregs by trogocytosis44 or transendocytosis45,46, it is not possible to know whether the CD80 protein observed in Tregs has been synthetized by the Treg, has been acquired from
the membrane of other cells, or both. These results indicate that CD80-expressing Tregs could define a subset of highly activated/suppressive Tregs associated with bad prognosis. These
results emerge as potential therapeutic targets for breast tumor-associated Tregs. DISCUSSION Studies on Tregs in breast cancer showed that the proportion of blood FOXP3+ CD4+ T cells is
increased compared with healthy donors47,48 and that in the tumor high proportions of FOXP3+ CD4+ T cells—detected by immunohistochemistry (IHC)—are associated with a bad
prognosis14,15,25,49. Data quantifying Tregs in breast cancer-TDLNs, is scarce18, and has been mainly obtained by FOXP3 detection by IHC that do not allow the distinction between the
suppressive CD4+ CD25+ FOXP3high T and the non-suppressive CD4+ CD25+ FOXP3low- T cells12,18,19,50. Our flow cytometry results establish that the high proportions of Tregs observed in TDLNs
and in the primary tumor microenvironment constitute “bona fide” Tregs. Although Tregs can lose their phenotypic stability and functions in pro-inflammatory microenvironments13,32,51, we
found that even in the presence of activated IFN-γ-producing CD4+ T cells, Tregs in I TDLNs maintained their ex vivo suppressor capacity and had a stable phenotype (as judged by the low
levels of cytokine production). Moreover, Tregs in TDLNs and in the tumor expressed high levels of CTLA-4, ICOS, GITR, and OX40, phenotype associated to a high suppressive capacity. It is
noteworthy that although the Tconvs showed signs of dysfunction in the tumor, the suppressor Eff Tregs did not, highlighting the latter’s ability to adapt to the tumor microenvironment. One
explanation to this observation could be that Tregs are more proficient than Tconvs to survive and function in the presence of hypoxia, acidosis, and nutrient deprivation52, which can be
assumed to be more stringent in the tumor than in the I TDLNs, owing to differences in tumor burden. Our observations have several clinical implications. The transcriptomic analysis of
purely sorted Tregs and Tconvs identified CD80-expressing Tregs as a subpopulation of Tregs associated to bad prognosis in breast cancer, which represents a candidate for the design of
immunoregulatory therapies, and merit further analysis to better understand its role in the biology of tumor-associated Tregs. Also, we found that Tregs from luminal breast cancer patients
showed a distinct pattern of highly expressed costimulatory and co-inhibitory molecules, including PD-1, CTLA-4, ICOS, GITR, OX40, and CD39, underscoring the value of these molecules as
targets for immunomodulation. As follows, the non-depleting, anti-CTLA-4 Ab Tremelimumab (but not the depleting Ab Ipilimumab) showed limited activity in metastatic melanoma and breast
cancer;24,53,54 what could be explained by its low capacity to deplete CTLA-4-expressing Tregs. Also, our data predict that depleting Abs that target ICOS, GITR, and OX40 (such as the
depleting anti-OX40 Ab MEDI646955) could be good candidate drugs for patients with luminal breast cancer. We observed that in TDLNs, Tregs and Tconvs show a similar pattern of chemokine
receptor expression, reinforcing the concept that the ability of Tregs to maintain local immune homeostasis depends on their appropriate colocalization with Tconvs13. Along these lines,
Redjimi et al.56 also showed that the proportion of CXCR3+ Tregs in ovarian tumors was directly correlated to that of CXCR3+ Tconvs. In addition, in I TDLNs we detected a significant
increase of Th1 cells compared with NI TDLNs, suggesting that nodal tumor invasion is associated to an IFN-γ-mediated T-cell response, which has been linked to potent antitumor
responses57,58. Moreover, a rich CD4+ Th1 signature in breast tumors has been associated with a good prognosis59. Also, I TDLNs showed higher proportions of Tfh cells. Interestingly, Faghih
et al.8 identified Tfr and CD4+ T cells producing IFN-γ, IL-4, and IL-17 in breast cancer tumors, and concluded that upon metastasis in the TDLNs, the immune response becomes more inhibited.
In line with our results, other studies found higher levels of T-cell clonality in the tumors than in the blood and in juxtatumoral tissues (and in the TDLNs in our study), with shared
clones found in tissues and tumors12,25,35,60. Assuming that the tumor-expanded clones are the tumor-specific ones, this observation underscores an ongoing antitumor response, leading to an
accumulation of tumor-specific CD4+ T cells in the tumor. Furthermore, the detection of shared β-CDR3s between tumor-expanded T-cell clones and T cells in TDLNs indicates circulation between
the tumor and the TDLNs, and underscores the potential contribution of TDLNs as source of tumor-specific T cells that might be modulated by immunotherapies. As suggested by Zemmour et
al.61, Tregs with the same TCR have similar transcriptional traits, implying that Tregs with shared antigenic specificity from tumors and TDLNs may also share an early imprinted specific
program that persists after priming and drive them to anatomical locations with common environmental cues. Furthermore, inter-tissue sharing of Treg clones could also be indicative of a
loco-regional suppression mechanism. Finally, ~20% of the tumor-Treg β-CDR3s were shared with Tconv cells, pointing out that an important fraction of the Tregs could arise through peripheral
induction or conversion of CD4+ Tconv cells. Along these lines, although Helios is not a marker exclusively for thymic Tregs, the high level of Helios expression in tumor and TDLN Tregs
(Supplementary Fig. 2) could reflect in situ peripheral Treg differentiation. Although the use of the same TCR in different subsets is suggestive but not demonstrative of a common clonal
origin, it has been recently shown in a mouse model38 that monoclonal CD4+ T-cell may become effector, anergic, or Treg in the TDLNs as soon as 7 days after priming. Of note, in all the
analyzed tissues Tregs were more clonally expanded that Tconvs, probably reflecting their more self-reactive repertoire. We identified a group of 121 common genes that characterize Tregs in
breast tumors, NI, and I TDLNs, and a list of distinctive genes associated to each location, pointing out their tissue adaptation. NI TDLN-Tregs are characterized by a homeostatic
proliferation signature, and I-TDLN-Tregs display a phenotype halfway between the NI and the tumor Tregs. Noteworthy, Tregs from NI TDLN are primed for antigen presentation, whereas Tregs
from I TDLN tend to apoptose, what may enhance their suppressive capacity, as reported by Maj et al.62. Tumor Tregs are characterized by an activation signature and by metabolic changes,
which may reflect their adaptation to the harsh metabolic conditions of the tumor microenvironment, characterized by hypoxia and acidosis, alterations in nutrient composition, like glucose
restriction, high levels of reactive oxygen species (ROS), adenosine, and prostaglandins63. Among the specific tumor-Treg features, we observed a higher expression of _IL1RL1_ (IL-33
receptor, _ST2_), which has been described to correlate with tumor number and size51 and with inhibition of IL-1-mediated inflammation41,42. Of note, we observed an association of the
_CD80/FOXP3_ mRNA ratio with poor OS and DFS in breast cancer patients. It has been reported that T cells can acquire CD80 at an early state of activation64. In Tregs, the presence of CD80
at the protein level has been described linked to trogocytosis44 or transendocytosis mediated by CTLA-445,46, and it has been associated as a mechanism of Treg-mediated suppression, as
restriction of costimulatory ligand expression in dendritic cells inhibits CD28-mediated activation of T cells. CD80 has also been associated to Treg signatures of bulk transcriptomic
data65. Only one recent work has also reported CD80 expression in activated Tregs12 in autoimmune patients, and warrants further understanding on the role of CD80 in Treg biology.
Hypermutated cancers are viewed as potentially good responders to immunomodulators, owing to the activation of neo-antigen-specific T cells in the tumor57,58,66. Breast cancers show low
mutational loads, and patients with this cancer have been less included in clinical trials of immune checkpoint inhibitors than more-mutated tumors such as melanoma or lung tumors, yet some
efficacy has been observed23,24. Adoptive T-cell therapy using neo-antigen specific autologous TILS combined with IL-2 and checkpoint blockade67 can also be effective in these patients.
Thus, combination of strategies boosting effector T cells with Treg-cell depletion should increase therapeutic efficacy of immunotherapies. Along these lines, our data provide information on
the phenotype and function of Tregs in luminal cancer patients, and add “LN-T cells” as a dimension to be considered in the design of effective immunotherapies for cancer patients. METHODS
CLINICAL SAMPLES TDLNs and tumors were collected from 54 patients with luminal breast cancer having undergone standard-of-care surgical resection at the Institut Curie Hospital (Paris,
France), in accordance with institutional ethical guidelines and informed consent was obtained. The protocol was approved by the Ethical Committee of Curie Institut (“Comité de la Recherche
Institutionnel”, CRI-0804-2015). The study cohort included patients for whom samples of the NI and I TDLNs and the primary tumor were available. The patients’ clinical and pathologic
characteristics are summarized in Supplementary Table 1. Tumor metastasis in TDLNs was diagnosed using histologic and IHC techniques (cytokeratin positivity). Primary tumors were
characterized by IHC screening of hormone receptors (estrogen receptor 1, encoded by _ESR1_, and the progesterone receptor, encoded by _PGR_), the tyrosine kinase cell surface receptor HER2
(also known as erbB-2 receptor tyrosine kinase 2, and CD340, encoded by _ERBB2_), and KI-67. Lymph node invasion by tumor cells was confirmed by Epcam/CD45 detection by flow cytometry.
SAMPLES AND CELL ISOLATION Samples were obtained within a few hours after the primary surgery, cut into small fragments, and digested with 0.1 mg/ml Liberase TL (Roche) in the presence of
0.1 mg/ml DNase (Roche) for 20 min before the addition of 10 mm ethylenediaminetetraacetic acid. Cells were filtered on a 40-μm cell strainer (BD Biosciences). PHENOTYPIC ANALYSIS OF IMMUNE
CELL POPULATIONS TDLNs and primary tumors were stained with the antibodies listed in Supplementary Table 5. Non-specific binding was blocked using anti-CD32 (Stem Cell). For intracellular
staining, cells were fixed and permeabilized with fixation/permeabilization solution (eBiosciences), according to the manufacturer’s instructions. All samples were acquired a few hours after
surgery. Data acquired with a BD LSR-Fortessa flow cytometer were compensated, exported into FlowJo software (version 10.0.8, TreeStar Inc.), and normalized using Cyt MATLAB (version
2017b). To obtain an unbiased overview, we systematically reduced the flow cytometry data to two dimensions by applying t-distributed stochastic neighbor embedding (t-SNE, which displayed
randomly selected live cells from TDLNs and primary tumors of all samples) in conjunction with FlowSOM clustering (which displayed all live cells from the three individual tissues of all
samples)68. INTRACELLULAR CYTOKINE STAINING TDLNs were stimulated for 4 h with 100 ng/ml of PMA and 1 μg/ml ionomycin in the presence of GolgiPlug (BD Biosciences) for the final 3 h of
culture. Cells were fixed and permeabilized with fixation/permeabilization solution (eBiosciences), according to the manufacturer’s instructions. Cells were stained with FOXP3-Alexa488
(clone 236 A/E7, eBiosciences), IL-17-BV711 (clone BL168; BioLegend) and IFNγ-V450 (clone B27; BD Biosciences), and then analyzed on a Fortessa flow cytometer (BD Biosciences). The FACS data
were analyzed with FlowJo software (version 10.0.8, TreeStar Inc.). CD80 STAINING Tumors from eight patients with breast cancer and 2 PBMC from heathy donors were stained twice first with
surface and then with intracellular staining with CD80-BV786 (clone L307.4; BD Biosciences) and IgG1k-BV786 (clone X40; BD Biosciences) isotype. TREG SUPPRESSION ASSAY CD4+, CD25+, and CD4+
CD25− T lymphocytes were first isolated using the CD4+ CD25+ regulatory T-cell isolation kit (Miltenyi Biotec, 130-091-301) and then stained with CD25−PE (clone M-A251; BD Biosciences) and
CD4-PE-CF594 (clone RPA-T4; BD Biosciences). CD4+ CD25− (Tconv) and CD4+ CD25high (Treg) cells were sorted by flow cytometry using a BD FACS ARIA II cell sorter. Tconvs were stained with
CFSE (5 µm) (Life Technologies) and co-cultured with autologous Tregs at varying concentrations in a 96-well round bottom plate (2.5 × 104 Tconvs per well) in the presence of Dynalbeads
CD3/CD28 T-cell expander (Life Technologies) at a ratio of 10 cells/bead. Cells were incubated at 37 °C for 4 days in Roswell Park Memorial Institute 1640 Medium (Life Technologies)
supplemented with 10% AB-human-serum and 1% penicillin–streptomycin, and were then analyzed using flow cytometry (BD LSR-Fortessa). Proliferation index was calculated with FlowJo
Proliferation Tool (TreeStar Inc.). CELL SORTING FOR RNA AND TCR SEQUENCING Matched NI, I, and TDLNs and primary tumors from patients with breast cancer were processed for RNA and/or TCR
sequencing. T cells were first isolated using the Pan T Cell isolation kit (Miltenyi Biotec, 130-096-535). Non-specific binding was blocked using anti-CD32 (Stem Cell), and cells were
stained with CD25−PE (clone M-A251; BD Biosciences), CD4-PE-CF594 (clone RPA-T4; BD Biosciences), CD8-Alexa700 (clone 3B5; Life Technologies), CD27-APC (clone L128; BD Biosciences) or
CD45RA-PE-Cy7 (clone HI100; BD Biosciences) and then with 4′,6-diamidino-2-phenylindole (DAPI) LIVE/DEAD stain. CD4+ CD45RA-CD25− (Memory CD4+ Tconv), CD4+ CD45RA-CD25high (Memory Treg),
were sorted by flow cytometry in a BD FACS ARIA II cell sorter, with a purity of 98–99. Cells were collected and lysed with TCL buffer (Qiagen) with 1% of β-mercaptoethanol and stored at −80
°C until subsequent analysis. RNA was isolated using a Single Cell RNA purification kit (Norgen), including RNase-Free DNase Set (Qiagen) treatment. The RNA integrity number was evaluated
with an Agilent RNA 6000 pico kit. All samples were assessed according to the manufacturer’s instructions. TCR SEQUENCING The RNA was extracted from all the sorted cells. After purification,
all the RNA was used for the reverse transcription step. A specific reverse transcription reaction was performed with constant TCRβ region primers (see below for the primer sequence)
coupled at the 5′-end to the common sequence 2 (CS2) TACGGTAGCAGAGACTTGGTCT using SuperScript IV (ThermoFisher). After synthesis, cDNA was cleaned using Agencourt RNAclean XP kit (Beckman
Coulter) according to the manufacturer’s instructions, and then eluted in 40 µl of RNAse-free water (Ambion). We used three PCR steps for cDNA amplification and barcoding. For PCR reaction
1, we used the same reverse constant primers as for reverse transcription, and we used previously described forward TCR sequence primers69. For the PCR reaction 1, the concentration of each
TCR region primer was 0.2 µm. We performed 17 cycles for the first PCR step to keep it in the exponential phase allowing > 10,000-fold amplification and an unbiased representation of all
the TCR β transcripts, using the following cycling conditions: 95 °C for 3 min, 90 °C for 30 s, 63 °C for 30 s, and 72 °C for 30 s. After the first multiplex PCR, cDNA was cleaned using an
Agencourt AMPure XP kit (Beckman Coulter) according to the manufacturer’s instructions, and eluted in 40 µl of RNAse-free water. After beads-based purification, 1/160th of the purified
product was used as template for the second PCR allowing a good representation of the initial template. For PCR reaction 2, we performed two distinct, seminested multiplex PCRs for TCRβ,
using previously described TCR variable region primers69 (Supplementary Table 6) coupled at the 5′ end to the common sequence 1 (CS1, ACACTGACGACATGGTTCTACA) primer. We used the first PCR
product as template, and seminested PCRs were performed in a 20 µl final reaction volume using GoTaq G2 Hot Start polymerase (Promega) according to the manufacturer’s instruction. We
performed 30 cycles with the following cycling conditions: 95 °C for 3 min, 90 °C for 30 s, 63 °C for 30 s, and 72 °C for 30 s. The cDNA was cleaned using an Agencourt AMPure XP kit
according to the manufacturer’s instructions, and resuspended in 40 µl of RNAse-free water. Barcoding and pair-end addition steps for Illumina sequencing were performed in a third PCR
reaction using PE1_CS1 forward primer and PE2_barcode_CS2 reverse primer (Fluidigm) at 400 nm. For this final PCR, we used the second PCR product as the template in a 20 µl final reaction
volume using Platinium Taq DNA Polymerase High Fidelity (ThermoFisher), with the following conditions: 94 °C for 10 min, 94 °C for 30 s, 60 °C for 30 s, 68 °C for 4 min, and 68 °C for 3 min.
The cDNA was cleaned using an Agencourt AMPure XP kit, according to the manufacturer’s instructions. Each PCR product had a unique barcode and a Fluidigm paired-end sequence that enable
sequencing on an Illumina Miseq system. The CS2 TCR primer sequence is TACGGTAGCAGAGACTTGGTCTTACCAGTGTGGCCTTTTGGGTGTG, with the common sequence is indicated in bold. We adapted the number of
reads per sample according to the initial number of cells. TCR-SEQUENCING ANALYSIS MiXCR70(version 2.1.5) was used with its default parameters to extract and quantify CDR3 sequences from
raw TCR sequence data. Using the MiXCR output, TCRβ clones were defined according to the identified V, J, and CDR3 sequences. To reduce noise, we first filtered out clones with fewer than
three counts and then selected the 90% most strongly expressed TCRβ clones for each sample. For the table 4, the percentage of shared clones was calculated as: number of shared clones/total
number of Treg clones × 100, for each tissue. RNA SEQUENCING Retrotranscription was carried out with SMARTv4 low input kit (Takara). Barcoded Illumina compatible libraries were generated
from 5 to 10 ng of DNA of each sample, using Nextera XTP reparation Kit. cDNA was generated using SMART-seq version 4 low input kit (Takara), Barcoded Illumina compatible libraries were
generated from 5 to 10 ng of DNA of each sample, using Nextera XTP reparation Kit. Libraries were sequenced on an Illumina HiSeq 2500 using 100 bp paired-end mode, 25 millions reads per
sample. RNA-SEQUENCING ANALYSIS FASTQ files were mapped to the ENSEMBL Human (GRCh38/hg38) reference using Hisat2 and counted by featureCounts from the Subread R package. Read count
normalization and groups comparisons were performed by three independent and complementary statistical methods: Deseq2, edgeR, LimmaVoom. Flags were computed from counts normalized to the
mean coverage. All normalized counts < 20 were considered as background (flag 0) and ≥ 20 as signal (flag = 1). P50 lists used for the statistical analysis regroup the genes showing flag
= 1 for at least half of the compared samples. The results of the three methods were filtered at _p_ value ≤ 0.05 and folds 1.2 compared and grouped by Venn diagram. Cluster analysis was
performed by hierarchical clustering using the Spearman correlation similarity measure and average linkage algorithm. Heatmaps were made with the R Version 1.1.463 (Cluster and Tree
Conversion) and imaged by Java Treeview software. Functional analyses were carried out using Ingenuity Pathway Analysis (IPA, Qiagen), Hugo Gene Nomenclature Committee (HGNC) and EnrichR.
SURVIVAL ANALYSIS To assess the association of gene expression level with the overall survival (OS, defined as time to death) and DFS (defined as time to recurrence or death), we used legacy
bulk RNA-seq data provided by The Cancer Genome Atlas (TCGA-BRCA, TCGAbiolinks package) obtained from 562 Luminal A, 209 Luminal B, 190 Basal, and 82 Her2+. As OS and DFS of _FOXP3_ mRNA
expression level per se is not a good read out of the well known contribution of Tregs to tumor scape, we used a bioinformatics strategy, as proposed by Plitas et al.12. In brief, first, for
the survival analysis we selected from the list of DEGs obtained from Fig. 6a, only those genes that positively correlated (_R_ > 0.5 and counts> 20 RPM) with FOXP3 reads per million
of mapped reads (RPM). Then, to evaluate the gene ratios, DEG RPMs were normalized by _FOXP3_ RPM and the obtained DEGs:FOXP3 proportions were used to segregate the breast cancer patients in
two groups (low and high) based on the median expression level. Statistical significance of the curves (OS and DFS) stratified by the above-mentioned groups was determined using a Log-rank
test (R package survival). STATISTICAL ANALYSIS Statistical significance was determined using Wilcoxon’s and Mann–Whitney’s test for paired and non-paired samples respectively and the
Pearson correlation coefficient. All statistical analyses were performed with Prism 6 software. Correlations between the immunological parameters and clinical/pathological data were probed
in a Pearson/Spearman correlation analysis (R software environment, version 3.4.0). REPORTING SUMMARY Further information on research design is available in the Nature Research Reporting
Summary linked to this article. DATA AVAILABILITY RNA-seq data that support the findings of this study have been deposited in ArrayExpress with the E-MTAB-9112 accession code RNA-seq.
TCR-seq data that support the findings of this study have been deposited in NCBI Gene Expression Omnibus with the GSE115545. The authors declare that all other data supporting the findings
of this study are available within the paper and its supplementary information files. REFERENCES * Cochran, A. J. et al. Tumour–induced immune modulation of sentinel lymph nodes. _Nat. Rev.
Immunol._ 6, 659–670 (2006). CAS PubMed Google Scholar * Munn, D. H. & Mellor, A. L. The tumor-draining lymph node as an immune-privileged site. _Immunol. Rev._ 213, 146–158 (2006).
PubMed Google Scholar * Tang, Q. et al. Central role of defective interleukin-2 production in the triggering of islet autoimmune destruction. _Immunity_ 28, 687–697 (2008). CAS PubMed
PubMed Central Google Scholar * Galimberti, V. & Cole, B. F. Axillary versus sentinel-lymph-node dissection for micrometastatic breast cancer – authors’ reply. _Lancet Oncol._ 14,
e251–e252 (2013). PubMed Google Scholar * Giuliano, A. E. et al. Effect of axillary dissection vs no axillary dissection on 10-year overall survival among women with invasive breast cancer
and sentinel node metastasis: the ACOSOG Z0011 (Alliance) randomized clinical trial. _JAMA_ 318, 918 (2017). PubMed PubMed Central Google Scholar * Swartz, M. A. & Lund, A. W.
Lymphatic and interstitial flow in the tumour microenvironment: linking mechanobiology with immunity. _Nat. Rev. Cancer_ 12, 210–219 (2012). CAS PubMed Google Scholar * Jones, D.,
Pereira, E. R. & Padera, T. P. Growth and immune evasion of lymph node metastasis. _Front. Oncol._ 8, 36 (2018). PubMed PubMed Central Google Scholar * Faghih, Z. et al. Immune
profiles of CD4+ lymphocyte subsets in breast cancer tumor draining lymph nodes. _Immunol. Lett._ 158, 57–65 (2014). CAS PubMed Google Scholar * Peters, J. H. et al. Human secondary
lymphoid organs typically contain polyclonally-activated proliferating regulatory T cells. _Blood_ 122, 2213–2223 (2013). CAS PubMed Google Scholar * Poindexter, N. J., Sahin, A., Hunt,
K. K. & Grimm, E. A. Analysis of dendritic cells in tumor-free and tumor-containing sentinel lymph nodes from patients with breast cancer. _Breast Cancer Res._ 6, R408 (2004). CAS
PubMed PubMed Central Google Scholar * Zuckerman, N. S. et al. Altered local and systemic immune profiles underlie lymph node metastasis in breast cancer patients. _Int. J. Cancer_ 132,
2537–2547 (2013). CAS PubMed Google Scholar * Plitas, G. et al. Regulatory T cells exhibit distinct features in human breast cancer. _Immunity_ 45, 1122–1134 (2016). CAS PubMed PubMed
Central Google Scholar * Chaudhary, B. & Elkord, E. Regulatory T cells in the tumor microenvironment and cancer progression: role and therapeutic targeting. _Vaccines (Basel)_ 4, pii:
E28 (2016). * Bates, G. J. et al. Quantification of regulatory T cells enables the identification of high-risk breast cancer patients and those at rsk of late relapse. _JCO_ 24, 5373–5380
(2006). Google Scholar * Merlo, A. et al. FOXP3 expression and overall survival in breast cancer. _JCO_ 27, 1746–1752 (2009). CAS Google Scholar * Duhen, T., Duhen, R., Lanzavecchia, A.,
Sallusto, F. & Campbell, D. J. Functionally distinct subsets of human FOXP3+ Treg cells that phenotypically mirror effector Th cells. _Blood_ 119, 4430–4440 (2012). CAS PubMed PubMed
Central Google Scholar * Kunicki, M. A., Amaya Hernandez, L. C., Davis, K. L., Bacchetta, R. & Roncarolo, M.-G. Identity and diversity of human peripheral Th and T regulatory cells
defined by single-cell mass. _Cytom. J. I._ 200, 336–346 (2018). CAS Google Scholar * van Pul, K. M. et al. Selectively hampered activation of lymph node-resident dendritic cells precedes
profound T cell suppression and metastatic spread in the breast cancer sentinel lymph node. _J. Immunother. Cancer_ 7, 133 (2019). PubMed PubMed Central Google Scholar * Kohrt, H. E. et
al. Profile of immune cells in axillary lymph nodes predicts disease-free survival in breast cancer. _PLoS Med._ 2, e284 (2005). PubMed PubMed Central Google Scholar * Nakamura, R. et al.
Accumulation of regulatory T cells in sentinel lymph nodes is a prognostic predictor in patients with node-negative breast cancer. _Eur. J. Cancer_ 45, 2123–2131 (2009). CAS PubMed Google
Scholar * Dougan, M., Dranoff, G. & Dougan, S. K. Cancer immunotherapy: beyond checkpoint blockade. _Annu. Rev. Cancer Biol._ 3, 55–75 (2019). Google Scholar * Yost, K. E. et al.
Clonal replacement of tumor-specific T cells following PD-1 blockade. _Nat. Med_ 25, 1251–1259 (2019). CAS PubMed PubMed Central Google Scholar * Adams, S. et al. Current landscape of
immunotherapy in breast cancer: a review. _JAMA Oncol._ 5, 1205 (2019). Google Scholar * Vonderheide, R. H. et al. Tremelimumab in combination with exemestane in patients with advanced
breast cancer and treatment-associated modulation of inducible costimulator expression on patient T cells. _Clin. Cancer Res._ 16, 3485–3494 (2010). CAS PubMed Google Scholar * Wang, L.
et al. Connecting blood and intratumoral Treg cell activity in predicting future relapse in breast cancer. _Nat. Immunol._ 20, 1220–1230 (2019). CAS PubMed Google Scholar * Chen, D. S.
& Mellman, I. Oncology meets immunology: the cancer-immunity cycle. _Immunity_ 39, 1–10 (2013). PubMed Google Scholar * Ruffell, B. et al. Leukocyte composition of human breast cancer.
_Proc. Natl Acad. Sci._ 109, 2796–2801 (2012). ADS CAS PubMed Google Scholar * Miyara, M. et al. Functional delineation and differentiation dynamics of human CD4+ T cells expressing the
FoxP3 transcription factor. _Immunity_ 30, 899–911 (2009). CAS Google Scholar * Nishikawa, H. & Sakaguchi, S. Regulatory T cells in cancer immunotherapy. _Curr. Opin. Immunol._ 27,
1–7 (2014). CAS PubMed Google Scholar * Joncker, N. T. et al. Antigen-independent accumulation of activated effector/memory T lymphocytes into human and murine tumors. _Int. J. Cancer_
118, 1205–1214 (2006). PubMed Google Scholar * Dominguez-Villar, M., Baecher-Allan, C. M. & Hafler, D. A. Identification of T helper type 1–like, Foxp3+ regulatory T cells in human
autoimmune disease. _Nat. Med._ 17, 673–675 (2011). CAS PubMed PubMed Central Google Scholar * Overacre-Delgoffe, A. E. et al. Interferon-γ drives T reg fragility to promote anti-tumor
immunity. _Cell_ 169, 1130–1141.e11 (2017). CAS PubMed PubMed Central Google Scholar * Feuerer, M., Hill, J. A., Mathis, D. & Benoist, C. Foxp3+ regulatory T cells: differentiation,
specification, subphenotypes. _Nat. Immunol._ 10, 689–695 (2009). CAS PubMed Google Scholar * Mahnke, Y. D., Brodie, T. M., Sallusto, F., Roederer, M. & Lugli, E. The who’s who of
T-cell differentiation: human memory T-cell subsets: HIGHLIGHTS. _Eur. J. Immunol._ 43, 2797–2809 (2013). CAS PubMed Google Scholar * Wang, T. et al. The different T-cell receptor
repertoires in breast cancer tumors, draining lymph nodes, and adjacent tissues. _Cancer Immunol. Res._ 5, 148–156 (2017). CAS PubMed Google Scholar * Lee, H.-M., Bautista, J. L. &
Hsieh, C.-S. Thymic and peripheral differentiation of regulatory T cells. _Adv. Immunol._ 112, 25–71 (Elsevier, 2011). * Lee, W. & Lee, G. R. Transcriptional regulation and development
of regulatory T cells. _Exp. Mol. Med._ 50, e456 (2018). CAS PubMed PubMed Central Google Scholar * Alonso, R. et al. Induction of anergic or regulatory tumor-specific CD4+ T cells in
the tumor-draining lymph node. _Nat. Commun._ 9, 2113 (2018). ADS PubMed PubMed Central Google Scholar * Buchan, S. L. et al. Antibodies to costimulatory receptor 4-1bb enhance
anti-tumor immunity via T regulatory cell depletion and promotion of CD8 T cell effector function. _Immunity_ 49, 958–970.e7 (2018). CAS PubMed Google Scholar * Zhang, T. et al. Aberrant
frequency of TNFR2+ Treg and related cytokines in patients with CIN and cervical cancer. _Oncotarget_ 9, 5073–5083 (2018). * Halvorsen, E. C. et al. IL-33 increases ST2 + Tregs and promotes
metastatic tumour growth in the lungs in an amphiregulin-dependent manner. _OncoImmunology_ 8, e1527497 (2019). CAS PubMed Google Scholar * Pastille, E. et al. The IL-33/ST2 pathway
shapes the regulatory T cell phenotype to promote intestinal cancer. _Mucosal Immunol._ 12, 990–1003 (2019). CAS PubMed Google Scholar * Liu, Y. et al. FOXP3 and CEACAM6 expression and T
cell infiltration in the occurrence and development of colon cancer. _Oncol. Lett._ 11, 3693–3701 (2016). CAS PubMed PubMed Central Google Scholar * Gu, P. et al. Trogocytosis of CD80
and CD86 by induced regulatory T cells. _Cell Mol. Immunol._ 9, 136–146 (2012). CAS PubMed PubMed Central Google Scholar * Ovcinnikovs, V. et al. CTLA-4-mediated transendocytosis of
costimulatory molecules primarily targets migratory dendritic cells. _Sci. Immunol._ 4, eaaw0902 (2019). * Zhao, Y. et al. PD-L1:CD80 cis-heterodimer triggers the co-stimulatory receptor
CD28 while repressing the inhibitory PD-1 and CTLA-4 pathways. _Immunity_ 51, 1059–1073.e9 (2019). CAS PubMed PubMed Central Google Scholar * Wolf, A. M. et al. Increase of regulatory T
cells in the peripheral blood of cancer patients. _Clin. Cancer Res._ 9, 606–612 (2003). PubMed Google Scholar * Liyanage, U. K. et al. Prevalence of regulatory T cells is increased in
peripheral blood and tumor microenvironment of patients with pancreas or breast adenocarcinoma. _J. Immunol._ 169, 2756–2761 (2002). CAS PubMed Google Scholar * Sun, S. et al. PD-1+
immune cell infiltration inversely correlates with survival of operable breast cancer patients. _Cancer Immunol. Immunother._ 63, 395–406 (2014). CAS PubMed Google Scholar * Gupta, R. et
al. The numbers of FoxP3+ lymphocytes in sentinel lymph nodes of breast cancer patients correlate with primary tumor size but not nodal status. _Cancer Investig._ 29, 419–425 (2011). CAS
Google Scholar * Zhou, X. et al. Instability of the transcription factor Foxp3 leads to the generation of pathogenic memory T cells in vivo. _Nat. Immunol._ 10, 1000–1007 (2009). CAS
PubMed PubMed Central Google Scholar * Overacre-Delgoffe, A. E. & Vignali, D. A. A. Treg fragility: a prerequisite for effective antitumor immunity? _Cancer Immunol. Res._ 6, 882–887
(2018). CAS PubMed PubMed Central Google Scholar * Furness, A. J. S., Vargas, F. A., Peggs, K. S. & Quezada, S. A. Impact of tumour microenvironment and Fc receptors on the activity
of immunomodulatory antibodies. _Trends Immunol._ 35, 290–298 (2014). CAS PubMed Google Scholar * Fritz, J. M. & Lenardo, M. J. Development of immune checkpoint therapy for cancer.
_J. Exp. Med._ 216, 1244–1254 (2019). CAS PubMed PubMed Central Google Scholar * Buchan, S. L., Rogel, A. & Al-Shamkhani, A. The immunobiology of CD27 and OX40 and their potential as
targets for cancer immunotherapy. _Blood_ 131, 39–48 (2018). CAS PubMed Google Scholar * Redjimi, N. et al. CXCR3+ T regulatory cells selectively accumulate in human ovarian carcinomas
to limit type I immunity. _Cancer Res._ 72, 4351–4360 (2012). CAS PubMed Google Scholar * Rosenberg, S. A. & Restifo, N. P. Adoptive cell transfer as personalized immunotherapy for
human cancer. _Science_ 348, 62–68 (2015). ADS CAS PubMed PubMed Central Google Scholar * Hu, Z., Ott, P. A. & Wu, C. J. Towards personalized, tumour-specific, therapeutic vaccines
for cancer. _Nat. Rev. Immunol._ 18, 168–182 (2018). CAS PubMed Google Scholar * Gu-Trantien, C. et al. CD4+ follicular helper T cell infiltration predicts breast cancer survival. _J.
Clin. Invest._ 123, 2873–2892 (2013). CAS PubMed PubMed Central Google Scholar * Beausang, J. F. et al. T cell receptor sequencing of early-stage breast cancer tumors identifies altered
clonal structure of the T cell repertoire. _Proc. Natl Acad. Sci. USA_ 114, E10409–E10417 (2017). CAS PubMed Google Scholar * Zemmour, D. et al. Single-cell gene expression reveals a
landscape of regulatory T cell phenotypes shaped by the TCR. _Nat. Immunol._ 19, 291–301 (2018). CAS PubMed PubMed Central Google Scholar * Maj, T. et al. Oxidative stress controls
regulatory T cell apoptosis and suppressor activity and PD-L1-blockade resistance in tumor. _Nat. Immunol._ 18, 1332–1341 (2017). CAS PubMed PubMed Central Google Scholar * Speiser, D.
E., Ho, P.-C. & Verdeil, G. Regulatory circuits of T cell function in cancer. _Nat. Rev. Immunol._ 16, 599–611 (2016). CAS PubMed Google Scholar * Tatari-Calderone, Z., Semnani, R.
T., Nutman, T. B., Schlom, J. & Sabzevari, H. Acquisition of CD80 by human T cells at early stages of activation: functional involvement of CD80 acquisition in T cell to T cell
interaction. _J. Immunol._ 169, 6162–6169 (2002). CAS PubMed Google Scholar * Bhairavabhotla, R. et al. Transcriptome profiling of human FoxP3+ regulatory T cells. _Hum. Immunol._ 77,
201–213 (2016). CAS PubMed Google Scholar * Schumacher, T. N. & Schreiber, R. D. Neoantigens in cancer immunotherapy. _Science_ 348, 69–74 (2015). ADS CAS PubMed Google Scholar *
Zacharakis, N. et al. Immune recognition of somatic mutations leading to complete durable regression in metastatic breast cancer. _Nat. Med._ 24, 724–730 (2018). CAS PubMed PubMed Central
Google Scholar * Nowicka, M. et al. CyTOF workflow: differential discovery in high-throughput high-dimensional cytometry datasets. _F1000Res_ 6, 748 (2017). PubMed Google Scholar * Han,
A., Glanville, J., Hansmann, L. & Davis, M. M. Linking T-cell receptor sequence to functional phenotype at the single-cell level. _Nat. Biotechnol._ 32, 684–692 (2014). CAS PubMed
PubMed Central Google Scholar * Bolotin, D. A. et al. MiXCR: software for comprehensive adaptive immunity profiling. _Nat. Methods_ 12, 380–381 (2015). CAS PubMed Google Scholar
Download references ACKNOWLEDGEMENTS We thank Vassili Soumelis, Emanuela Romano, and Clotilde Théry for discussions and critical review of the manuscript, Zofia Maciorowski and the Institut
Curie Flow Cytometry facility for cell sorting, André Nicolas, Ana Tereza Nadan, and Nathalie Amzallag for technical assistance, Phil Cheng for TCGA data analysis support and the Institut
Curie NSG platform facility. We also thank the TCGA for providing breast cancer RNA-seq and clinical data sets. This work was funded by the Institut National de la Santé et de la Recherche
Médicale (INSERM); the Association pour la Recherche sur le Cancer (ARC); the Institut Curie; the Agence Nationale pour la Recherche (ANR Emergence program); the Institut National du Cancer
(INCa), IGR-Curie 1428 Clinical Investigation Center, Labex DCBIOL (ANR-10-IDEX-0001-02 PSL* and ANR-11-LABX0043), SIRIC (INCa-DGOS-Inserm_12554, projets 2011–2017:INCa-DGOS-Inserm_4654).
N.G.N. received a fellowship from Ligue Nationale Contre le Cancer and the University Research Priority Program (URPP). AUTHOR INFORMATION Author notes * Nicolas Gonzalo Núñez Present
address: Institute of Experimental Immunology, University of Zurich, Winterthurerstr. 190, CH-8057, Zurich, Switzerland * Xavier Sastre-Garau Present address: Institut de Cancerologie de
Lorraine Department of Biopathology, 6, avenue de Bourgogne CS 30519, 54519, Vandoeuvre-lès-Nancy cedex, France * These authors contributed equally: Nicolas Gonzalo Núñez, Jimena Tosello.
AUTHORS AND AFFILIATIONS * Institut Curie, PSL Research University, INSERM U932, F-75005, Paris, France Nicolas Gonzalo Núñez, Jimena Tosello Boari, Rodrigo Nalio Ramos, Wilfrid Richer,
Leticia Laura Niborski, Jeremy Bigot, Philippe De La Rochere, Sophie Viel, Delphine Loirat, Louis Pérol, Christine Sedlik, Olivier Lantz, Sebastian Amigorena & Eliane Piaggio *
Paris-Descartes Bioinformatics Platform, 75015, Paris, France Nicolas Cagnard * Institute of Experimental Immunology, University of Zurich, Winterthurerstr. 190, CH-8057, Zurich, Switzerland
Cyrill Dimitri Anderfuhren & Becher Burkhard * Institut Curie, PSL Research University, Departement de Biologie des Tumeurs, F-75005, Paris, France Didier Meseure, Maud Milder, Anne
Vincent-Salomon, Xavier Sastre-Garau & Olivier Lantz * Centre d’Investigation Clinique Biotherapie CICBT 1428, Institut Curie, Paris, F-75005, France Didier Meseure, Maud Milder,
Delphine Loirat, Anne Vincent-Salomon, Christine Sedlik, Olivier Lantz, Sebastian Amigorena & Eliane Piaggio * Institut Curie, PSL Research University, Departement d’Oncologie Medicale,
F-75005, Paris, France Delphine Loirat Authors * Nicolas Gonzalo Núñez View author publications You can also search for this author inPubMed Google Scholar * Jimena Tosello Boari View author
publications You can also search for this author inPubMed Google Scholar * Rodrigo Nalio Ramos View author publications You can also search for this author inPubMed Google Scholar * Wilfrid
Richer View author publications You can also search for this author inPubMed Google Scholar * Nicolas Cagnard View author publications You can also search for this author inPubMed Google
Scholar * Cyrill Dimitri Anderfuhren View author publications You can also search for this author inPubMed Google Scholar * Leticia Laura Niborski View author publications You can also
search for this author inPubMed Google Scholar * Jeremy Bigot View author publications You can also search for this author inPubMed Google Scholar * Didier Meseure View author publications
You can also search for this author inPubMed Google Scholar * Philippe De La Rochere View author publications You can also search for this author inPubMed Google Scholar * Maud Milder View
author publications You can also search for this author inPubMed Google Scholar * Sophie Viel View author publications You can also search for this author inPubMed Google Scholar * Delphine
Loirat View author publications You can also search for this author inPubMed Google Scholar * Louis Pérol View author publications You can also search for this author inPubMed Google Scholar
* Anne Vincent-Salomon View author publications You can also search for this author inPubMed Google Scholar * Xavier Sastre-Garau View author publications You can also search for this
author inPubMed Google Scholar * Becher Burkhard View author publications You can also search for this author inPubMed Google Scholar * Christine Sedlik View author publications You can also
search for this author inPubMed Google Scholar * Olivier Lantz View author publications You can also search for this author inPubMed Google Scholar * Sebastian Amigorena View author
publications You can also search for this author inPubMed Google Scholar * Eliane Piaggio View author publications You can also search for this author inPubMed Google Scholar CONTRIBUTIONS
N.G.N., J.T.B., C.S. O.L., and E.P. designed experiments and wrote the manuscript; N.G.N., J.T.B., R.N.R., L.L.N., J.B., W.R., P.D., S.V., and L.P. performed experiments; D.M., A.T.N.,
A.V.S., X.S.-G., and D.L. provided patient samples and clinical information; M.M. and D.L. provided logistic support and managed patient databases, W.R., N.G.N., N.C. and C.D.A. provided
bioinformatics assistance, C.S., B.B., R.N.R., and S.A. provided critical design input and edited the manuscript; and E.P. conceived the study. CORRESPONDING AUTHOR Correspondence to Eliane
Piaggio. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare no competing interests. ADDITIONAL INFORMATION PEER REVIEW INFORMATION _Nature Communications_ thanks the anonymous
reviewers for their contribution to the peer review of this work. Peer review reports are available. PUBLISHER’S NOTE Springer Nature remains neutral with regard to jurisdictional claims in
published maps and institutional affiliations. SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION PEER REVIEW FILE DESCRIPTIONS OF ADDITIONAL SUPPLEMENTARY FILES SUPPLEMENTARY DATA 1
SUPPLEMENTARY DATA 2 SUPPLEMENTARY DATA 3 REPORTING SUMMARY RIGHTS AND PERMISSIONS OPEN ACCESS This article is licensed under a Creative Commons Attribution 4.0 International License, which
permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless
indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or
exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Reprints
and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Núñez, N.G., Tosello Boari, J., Ramos, R.N. _et al._ Tumor invasion in draining lymph nodes is associated with Treg accumulation in
breast cancer patients. _Nat Commun_ 11, 3272 (2020). https://doi.org/10.1038/s41467-020-17046-2 Download citation * Received: 24 January 2020 * Accepted: 04 June 2020 * Published: 29 June
2020 * DOI: https://doi.org/10.1038/s41467-020-17046-2 SHARE THIS ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link Sorry, a shareable
link is not currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative
Trending News
Rand paul calls for bipartisanship, immigration votes, and no more 'ridiculous' shutdown blame gamesIn an appearance on CNN's _State of the Union_ Sunday, Sen. Rand Paul (R-Ky.) went after both parties for their con...
Children first | Nature MedicineDrugs administered to children with cancer were typically developed under the assumption that childhood cancers are simi...
Leg up for regional land | The West AustralianJack McGinnThe West Australian The State Government recently announced a series of affordable land packages designed to ...
404404. Ошибка Такой страницы не существует или она была удалена, попробуйте воспользоваться поиском или перейдите на главн...
Australia’s sigma healthcare signs $5. 8 billion merger deal with chemist warehouseAustralia’s Sigma Healthcare signs $5.8 billion merger deal with Chemist Warehouse | WTVB | 1590 AM · 95.5 FM | The Voic...
Latests News
Tumor invasion in draining lymph nodes is associated with treg accumulation in breast cancer patientsABSTRACT Tumor-draining lymph node (TDLN) invasion by metastatic cells in breast cancer correlates with poor prognosis a...
404 errorBriton wins right to be on EU electoral roll in historic French court ruling The order is the first of its kind since Br...
330 influence of biological maturation on the determin-ants of response to furosemideABSTRACT The effect of age on the determinants of the diuretic response to furosemide was evaluated in 22 infants (9 pre...
Guy pearce reveals former co-star kevin spacey was 'handsy' with himBy MARTA JARY FOR DAILY MAIL AUSTRALIA Published: 01:01 EDT, 3 July 2018 | Updated: 08:06 EDT, 3 July 2018 Guy Pearce ha...
The haunting of hill house cast: who plays poppy hill?WARNING: THIS ARTICLE CONTAINS SPOILERS FOR THE HAUNTING OF HILL HOUSE. In the complex history of Netflix’s The Haunting...