Enhanced ferroptosis sensitivity promotes the formation of highly myopic cataract via the ddr2-hippo pathway

ABSTRACT Highly myopic cataract (HMC) is a leading cause of blindness among the working-age individuals, with its pathogenesis poorly understood. This study aimed to elucidate the role of

ferroptosis in HMC development as well as the underlying mechanisms. In HMC lens epithelia, levels of Fe2+ and lipid peroxidation were found elevated, with increased vulnerability towards

ferroptosis as revealed by transmission electron microscopy. Mechanistically, RNA sequencing of HMC lens epithelial samples identified up-regulated expression of discoidin domain receptor

tyrosine kinase 2 (DDR2) as a key factor, which could enhance ferroptosis sensitivity via the Src-Hippo pathway. Specifically, DDR2 interacted with Src kinase, leading to the nuclear

translocation of homologous transcriptional regulators (yes-associated protein 1 [YAP1] and WW domain containing transcription regulator 1 [WWTR1]) of the Hippo pathway, which altered the

expression level of ferroptosis-related genes. Notably, highly myopic eyes of mice exhibited higher sensitivity to RSL3, a ferroptosis inducer, manifested as more severe nuclear lens

opacities both in vitro and in vivo compared with the contralateral control eyes, which could be alleviated by inhibitors of either ferroptosis or DDR2. Altogether, these findings

highlighted the role of DDR2 in mediating ferroptosis in HMC formation, providing a novel insight for therapeutic interventions. SIMILAR CONTENT BEING VIEWED BY OTHERS UPREGULATION OF

FERROPTOSIS IN GLUCOCORTICOIDS-INDUCED POSTERIOR SUBCAPSULAR CATARACTS Article Open access 15 April 2025 TGF-Β1-INDUCED M6A MODIFICATIONS ACCELERATE ONSET OF NUCLEAR CATARACT IN HIGH MYOPIA

BY MODULATING THE PCP PATHWAY Article Open access 24 April 2025 ABSENCE OF S100A4 IN THE MOUSE LENS INDUCES AN ABERRANT RETINA-SPECIFIC DIFFERENTIATION PROGRAM AND CATARACT Article Open

access 26 January 2021 INTRODUCTION The prevalence of high myopia is increasing globally and has become a worldwide health challenge [1, 2]. Highly myopic cataract (HMC), the most common

complication of high myopia, manifests approximately a decade earlier than the age-related cataract (ARC) [3], significantly impacting individuals’ quality of life during their working

years. Surgical intervention for HMC is particularly challenging due to the typically hard lens nuclei. Thus, a comprehensive understanding of the underlying pathogenesis of HMC is

imperative for the development of potential therapeutic methods [4]. Previous studies have reported that the highly methylated epigenetic modification of antioxidant and α-crystallin genes

precipitates the early onset of HMC [3, 5]. Nonetheless, these studies have not fully elucidated the reason why HMC features severer nuclear opacity. Ferroptosis, a type of programmed cell

death, first described in 2012 [6], is characterized by increased levels of redox-active iron and elevated lipid peroxidation. Recent research has shown its involvement in the formation of

ARC [7,8,9,10]. Nonetheless, the role of ferroptosis in HMC remains unexplored. Given that HMC lens exhibits many features associated with ferroptosis, such as elevated malondialdehyde

(MDA), increased oxidatively active substances, and reduced glutathione (GSH), compared with emmetropic eyes [11,12,13], it is plausible to consider ferroptosis as an essential mechanism

underlying the development of HMC. Notably, lenses from highly myopic eyes exhibit overgrowth and larger diameters than those from emmetropic eyes [14]. The Hippo pathway, a classical

signaling pathway regulating organ size, becomes relevant in this context [15] because inhibiting the Hippo pathway leads to increased tissue/organ size [16, 17]. Moreover, discoidin domain

receptor tyrosine kinase 2 (DDR2), which can be activated by extracellular matrix collagen, has been implicated in facilitating ferroptosis sensitivity through the Hippo pathway [18]. Based

on this evidence, we hypothesize that DDR2 modulates ferroptosis through the Hippo pathway in HMC. To corroborate our hypothesis, we assessed the ferroptosis sensitivity in HMC and conducted

further mechanistic experiments. Our finding confirmed an elevated ferroptosis sensitivity in HMC, resulting from DDR2 overexpression. Additionally, we also demonstrated that DDR2

overexpression enhanced ferroptosis sensitivity mainly via the Src-Hippo pathway. RESULTS HIGHLY MYOPIC LENSES EXHIBIT INCREASED SENSITIVITY TO FERROPTOSIS To test the hypothesis that lens

epithelia from highly myopic eyes are more sensitive to ferroptosis, we assessed the levels of intrinsic Fe2+ and lipid peroxidation using FerroOrange and C11/BODIPY in human and mouse lens

epithelia. In human lens epithelial samples, significantly elevated Fe2+ and lipid peroxidation levels were detected in HMC compared with ARC (Fig. 1a–d). Then, the Transmission Electron

Microscopy (TEM) revealed that after a 4-hour treatment with 1 μM RSL3, an inducer of ferroptosis (dissolved in DMSO), lens epithelia from HMC exhibited more condensed mitochondria and

deteriorated cristae (Fig. 1e), compared with the ARC group. To further validate this phenomenon, we constructed a lens-induced myopia mouse model, which also displayed heightened Fe2+ and

lipid peroxidation levels in the highly myopic lens epithelia compared with the contralateral lens epithelia (Fig. 1f–i). Moreover, lens explants were cultured in vitro and after a 72-hour

exposure to 10 μM RSL3, lenses from highly myopic eyes exhibited more severe nuclear opacity than the contralateral eyes (Fig. 1j, k). These findings support the notion of augmented

ferroptosis sensitivity in highly myopic lenses. UPREGULATION OF DDR2 ENHANCES FERROPTOSIS SENSITIVITY IN HIGHLY MYOPIC LENS To investigate the mechanism underlying the heightened

ferroptosis sensitivity of highly myopic lens, an RNA sequencing was conducted using human lens epithelial samples. After filtering out genes with low expression (Fig. S1a, b) and checking

the mean-variance change (Fig. S1c), 479 significantly upregulated genes and 689 significantly downregulated genes were identified in HMC compared with ARC (Fig. 2a). Intersection of the

significantly upregulated genes with known ferroptosis driver genes yielded 5 common genes (Fig. S1d), while intersection of significantly downregulated genes with suppressor genes yielded 8

common genes (Fig. S1e). Figure 2b, c illustrates the top ten driver genes showing upregulation and top ten suppressor genes showing downregulation in HMC, both selected based on the

smallest p-values. Among these 20 genes, DDR2 and Vitamin D receptor (VDR) emerged as predominant genes (Fig. 2d), with only increased protein levels of DDR2 being verified subsequently

(Fig. 2e–h). The expression level of VDR in lens epithelia is too low as revealed by quantitative PCR (qPCR). Besides, we found that cells treated with exogenous transforming growth factor

β1 (TGF-β1) showed increased DDR2 expression (Fig. S2a, b) and enhanced ferroptosis sensitivity (Fig. S2c, d). TGF-β1 is a cytokine that has been proven to increase in the aqueous humor of

highly myopic eyes [19], which may be a potential cause of DDR2 overexpression. Furthermore, to validate the impact of DDR2 on ferroptosis, DDR2 overexpressing (DDR2-OE) SRA 01/04 cell line

(a human lens epithelial cell line) was constructed. Quantitative PCR (Fig. 3a) and Western blotting assays (Fig. 3b, c) confirmed the successful construction. CCK-8 indicated that DDR2-OE

cells exhibited more declined cell viability (Fig. 3d) when treated with various concentrations of Erastin (another ferroptosis inducer) or RSL3, than the control group. Additionally, we

also found elevated levels of Reactive oxygen species (ROS) (Fig. 3e), lipid peroxidation (Fig. 3f, g), Fe2+ (Fig. 3h, i), and MDA (Fig. 3j) in the DDR2-OE cells following treatment with

Erastin or RSL3. Furthermore, Annexin-V/PI flow cytometry analysis (Fig. S3a) demonstrated that only Ferrostatin-1 (a ferroptosis inhibitor), but not Z-VAD-FMK (an apoptosis inhibitor) or

Bafilomycin A1 (an autophagy inhibitor), significantly reduced the cell death induced by RSL3, suggesting that RSL3-induced cell death was attributed to ferroptosis rather than apoptosis or

autophagy. Similarly, the caspase 3/7 staining (Fig. S3b) and CCK-8 assay (Fig. S3c, d) showed consistent results. Collectively, above findings demonstrate that DDR2 overexpression notably

enhances ferroptosis susceptibility in highly myopic lens. DDR2 PROMOTES FERROPTOSIS SENSITIVITY THROUGH THE HIPPO PATHWAY A previous study has shown that DDR2 overexpression could regulate

ferroptosis sensitivity through the Hippo pathway [18]. In light of this, we investigated the expression levels of two downstream effectors of the Hippo pathway: Yes-associated protein 1

(YAP1) and WW domain containing transcription regulator 1 (WWTR1, also known as TAZ), as well as two canonical target genes of YAP1/WWTR1: CTGF and CYR61. mRNA levels of CTGF and CYR61 were

significantly elevated in DDR2-OE cells, while those of YAP1 and WWTR1 remained unchanged (Fig. 4a). Based on these initial findings, we delved deeper into the subcellular localization of

YAP1 and WWTR1 by Western blotting (Fig. 4b, c) and immunofluorescence (Fig. 4e), revealing that DDR2 overexpression increased the nuclear levels of YAP1 and WWTR1. To further elucidate how

Hippo pathway regulates ferroptosis. We transfected cells with a plasmid carrying YAP1 gene with the S127A mutation, which specifically localizes YAP1 protein to the nucleus. YAP1

overexpression (YAP1-OE) cells exhibited enhanced YAP1 activity by increasing CTGF and CYR61 expression (Fig. S4a), and led to elevated ferroptosis sensitivity (Fig. 4f, Fig. S4b, c). This

sensitivity could be rescued by Verteporfin (a YAP1 inhibitor) or Ferrostatin-1 (Fig. 4f). Then the protein and mRNA levels of three key ferroptosis-related genes: acyl-CoA synthetase

long-chain family 4 (ACSL4), transferrin receptor protein 1 (TfR1), and glutathione peroxidase 4 (GPX4) were examined in YAP1-OE cells. We observed elevated ACSL4 and TfR1 protein levels and

reduced GPX4 levels (Fig. 4h, i). Results of qPCR and dual-luciferase reporter assays confirmed that YAP1 cooperated with the transcription factor TEAD4 and directly binded to the promoters

of ACSL4 and TfR1, enhancing their transcription activity (Fig. 4g, j). The unchanged GPX4 mRNA level suggested that YAP1 may have reduced GPX4 protein through post-translational

modulation, as YAP1 has been shown to suppress the deubiquitinase USP31 [20]. Supporting this, immunoprecipitation assays revealed higher levels of ubiquitinated GPX4 in YAP1-OE cells, and

treatment with the proteasome inhibitor MG132 restored GPX4 protein levels (Fig. 4k, l). Moreover, similar gene expression changes were observed in primary lens epithelia transduced with

DDR2-OE virus (Fig. S4d). Together, these results demonstrate that DDR2 enhances ferroptosis sensitivity via nuclear translocation of YAP1 and the subsequent regulation of

ferroptosis-related genes. DDR2 REGULATES THE HIPPO PATHWAY BY INTERACTING WITH SRC Then in order to elucidate how DDR2 regulated the Hippo pathway, we conducted a co-IP experiment to verify

the interaction between DDR2 and a reported kinase Src [21]. Results revealed that Src could be pulled down by DDR2, with increased levels observed in DDR2-OE cells (Fig. 5b). A counter

experiment using the Src antibody to pull down DDR2 yielded consistent results (Fig. S4f). Following this, we carried out a Src knockdown in DDR2-OE cells. Fig. S4g demonstrated the

knockdown efficiency of three siRNAs and the siRNA-2 was adopted afterwards. Western blotting confirmed the reduced Src protein levels after knockdown (Fig. S4h). Notably, we also found that

Src knockdown lowered the expression of YAP1, CTGF, and CYR61 (Fig. 5c), as well as diminished nuclear levels of YAP1 and WWTR1 (Fig. 5d), thereby rescued the heightened ferroptosis

sensitivity in DDR2-OE cells (Fig. 5e–g). Collectively, these results indicate that DDR2 regulate the Hippo pathway by interacting with Src (Fig. 5a). INHIBITING DDR2 MEDIATED FERROPTOSIS

MITIGATES THE CATARACT FORMATION IN HIGHLY MYOPIC MICE Experiments were conducted to investigate the potential of alleviating ferroptosis of lens epithelia through the DDR2-Src-Hippo

pathway, and possible mitigation of HMC in a mouse model. As Fig. 6a showed, death of DDR2-OE cells induced by RSL3 could be rescued by Dasatinib (a DDR2 inhibitor), Verteporfin, Saracatinib

(a Src inhibitor), and Ferrostatin-1 to varying extents. Crystal violet staining further confirmed these results (Fig. 6b). Lens explants extracted from highly myopic eyes and contralateral

eyes were cultured with RSL3, with or without Ferrostatin-1 or Dasatinib. After 72 h, the highly myopic lens exhibited increased opacity, which could be mitigated by Ferrostatin-1 and

Dasatinib (Fig. 6c). Furthermore, 10 μM RSL3 was injected to the anterior chamber to induce nuclear cataract formation in vivo. Fig. S5a illustrated a positive correlation between cataract

severity and RSL3 concentration and exposure time. Also, on the fifth-day post-injection, the GSH/ Glutathione oxidized (GSSG) ratio in both lens cortex and nucleus significantly reduced

(Fig. S5b), accompanied by obvious nuclear opacity as evaluated by optical coherence tomography (Fig. 6d). We further apply the RSL3 injection to the highly myopic model to mimic HMC in

vivo, with flowchart depicted in Fig. 6e. Specifically, after wearing lenses for 28 days, spectacles were removed and 10 μM RSL3 were injected. Ocular photos taken at the fifth day after

injection showed that highly myopic eyes developed more severe nuclear opacity than contralateral eyes in vitro, and the use of Ferrostatin-1 and Dasatinib could alleviate lens opacity (Fig.

6f). Together, these results show that inhibiting DDR2 activity and ferroptosis is able to alleviate ferroptosis-related HMC formation. DISCUSSION HMC is a leading cause of blindness,

posing significant challenges to visual health. Yet, the precise pathological mechanisms underlying HMC remain elusive. Our study demonstrated that lens epithelia from highly myopic eyes

were more sensitive to ferroptosis, which was a critical contributor to the severe nuclear opacity observed in HMC. Notably, we provided further evidence that the overexpression of DDR2

enhanced ferroptosis sensitivity, via the Src-Hippo signaling pathway. We also found that applying ferroptosis or DDR2 inhibitors can mitigate ferroptosis-associated HMC both in vivo and in

vitro, offering promising therapeutic targets for potential HMC treatment. Previous studies have highlighted that highly myopic eyes exhibit more characteristics related to ferroptosis

compared with emmetropic eyes. For example, Micelli-Ferrari et al. reported lower GSH levels (essential for oxidative damage protection) in HMC compared to ARC [13]. Similarly, the

subretinal fluid of highly myopic eyes contained significantly higher concentrations of lipid peroxidation products than emmetropic eyes [22]. Chen et al. identified activation of

ferroptosis pathways in the myopic corneal stroma using proteomic analyses [23]. Consistent with these findings, our study confirmed that lens epithelial samples from HMC were more sensitive

to ferroptosis. Notably, intraocular injection of RSL3, a ferroptosis inducer, successfully induced more severe nuclear cataract in highly myopic eyes compared to contralateral eyes. These

results suggest that heightened ferroptosis sensitivity in lens epithelia contributes to the formation of severe lens nuclear opacity in highly myopic eyes. We identified DDR2 as a key

protein overexpressed in lens epithelia of HMC, contributing to increased ferroptosis sensitivity. DDR2-mediated signaling has been previously linked to the activation of Src kinase

[24,25,26,27]. Lin et al. reported that DDR2 promoted ferroptosis sensitivity through the Src-Hippo axis in recurrent breast cancer [18]. Similarly, our findings revealed that DDR2 regulated

the Hippo pathway in lens epithelia by activating Src. Specifically, the intracellular segment of DDR2 directly interacted with Src, leading to the nuclear translocation of YAP1 and WWTR1,

two homologous transcriptional coactivators of the Hippo pathway. The roles of YAP1/WWTR1 in regulating ferroptosis have been demonstrated in various studies, though their downstream targets

differ. Yang et al. reported that WWTR1 knockdown reduced ferroptosis sensitivity through the regulation of ANGPTL4-NOX2 axis in ovarian cancer [28], and Wu et al. and He et al. reported

that YAP1 promotes ferroptosis through the upregulation of ACSL4 [29, 30]. Additional studies link YAP1/WWTR1 to ferroptosis regulation via SKP2, ALOXE3, and TfR1 [31,32,33]. In this study,

we observed that nuclear translocation of YAP1 enhanced ferroptosis sensitivity in lens by upregulating ACSL4 and TfR1, and downregulating GPX4. ACSL4, TfR1, and GPX4 are all important

ferroptosis regulatory genes. ACSL4 activates long-chain polyunsaturated fatty acids and is essential for ferroptosis execution; TfR1, a membrane receptor component of transferrin,

contributes to the cellular iron pool required for ferroptosis; GPX4 serves to interrupt lipid peroxidation. More specifically, the nuclear translocation of the YAP1 protein promoted the

transcription of ACSL4 and TfR1 by binding directly to their promoters with TEAD4 and reduced the GPX4 protein level post-translationally by increasing its ubiquitination. Interestingly, we

observed that lens epithelia treated with exogenous TGF-β1 increased DDR2 expression and ferroptosis sensitivity, in line with previous studies [34, 35]. As reported earlier, TGF-β1 levels

in the aqueous humor of highly myopic eyes are higher than those in emmetropic eyes [14, 19, 36]. We speculate that this may be one of the potential reasons of increased DDR2 expression in

lens epithelia of highly myopic eyes. In conclusion, our study unveiled the functional and mechanistic role of ferroptosis in HMC pathogenesis. We identified that DDR2 overexpression in

highly myopic eyes contributed to the enhanced ferroptosis sensitivity via the Src-Hippo pathway (Fig. 7). In vivo anterior chamber injection of RSL3 induced more severe lens nuclear opacity

in a highly myopic mouse model, which could be partially ameliorated by ferroptosis and DDR2 inhibitors. These findings underscore DDR2-mediated ferroptosis as a potential therapeutic

target for HMC intervention. MATERIALS AND METHODS HUMAN LENS CAPSULE SAMPLES In this study, high myopia was identified as eyes with axial length of ≥26.00 mm, while emmetropia was defined

as eyes with axial length ranging from 22.00 mm to 24.50 mm. During standard cataract surgeries, anterior lens capsules were peeled off during capsulorhexis. Specimens were immediately

spread on culture dishes for cell staining, or treated with ferroptosis inducers, or stored at −80 °C until further experiments (RNA extraction and protein isolation). For qPCR, a single

piece of lens capsule constituted one sample. For Western blotting, 3 pieces of lens capsules were pooled to provide sufficient protein for robust analysis. TEM For TEM analysis, lens

capsules obtained from surgeries were immediately spread on the filter paper and then treated with 1 μM RSL3 or DMSO for 4 h. The samples were then fixed overnight in a combination of 2%

paraformaldehyde and 2.5% glutaraldehyde. Then steps including washing, dehydration, and embedding in resin, were performed according to established protocols. Embedded samples were

sectioned using a Leica EM UC7 ultramicrotome (Leica, Wetzlar, Germany). The morphology of mitochondria was examined under a Hitachi HT7800 electron microscope (Tokyo, Japan) operating at 80

 kV. LENS-INDUCED HIGH MYOPIA MOUSE MODEL Four-week-old male C57BL/6 mice were bought from Chengxi Biotech Company (Shanghai, China), reared with free access to water and food under a 12-h

light-dark cycle. In all procedures, the mice were anesthetized using a solution of 1% sodium pentobarbital (100 mg/kg, i.p.; Sanshu, Beijing, China) and 10 mg/kg xylazine (Huamu, Beijing,

China). An infrared photorefractor (Striatech, Germany) was used to assess the refractive state. Only mice displaying less than 1.00 D of refractive disparity between two eyes were selected

for inclusion. Theses mice were randomly allocated to the high myopia group or the control group using random number tables. As we previously reported [37, 38], defocus-induced high myopia

model was established by affixing spectacles to the skull of the mouse. The right eye was fitted with a − 30 D lens, while the left eye wore a 0 D lens as a control. Daily checks ensured the

spectacles remained securely attached. After 4 weeks, the refractive states of the mice were measured again. Mice showing a myopic shift of at least 6.00 D in the right eye compared to the

left eye were considered successful models of defocus-induced high myopia. Due to visibly distinguishable treatments, blinding was not used. Then lens capsules were harvested for

fluorescence staining or Western blotting. In Western blotting, 4 pieces of capsules were pooled to provide sufficient protein for robust analysis. LENS EXPLANT Eyes from successful high

myopia models were harvested, disinfected with iodophor and immediately submerged in normal saline maintained at 37 °C. Then the lenses were extracted and cultured in high glucose Dulbecco’s

Modified Eagle Medium (DMEM; 11965092; Gibco, Carlsbad, CA, USA) medium containing 20% Fetal Bovine Serum (SV30208; Cytiva, Marlborough, MA, USA), 100 units/mL penicillin and 100 µg/mL

streptomycin (both 15140122; Gibco) under the condition of 5% CO2 at 37 °C. Lenses were exposed to reagents according to the experiment design and images were captured using a

stereomicroscope against a black cross background. Referring to the approach proposed by Kubo et al and Takashima et al. [39, 40], nuclear cataract extent was quantified by calculating the

ratio of the projection area of nuclear opacification to that of the whole lens using the ImageJ software. GENE EXPRESSION ANALYSIS BY RNA SEQUENCING Total RNA was extracted using the TRIzol

reagent (Invitrogen, CA, USA) according to the manufacturer’s protocol. RNA purity and quantification were evaluated with the NanoDrop ND-1000 spectrophotometer (Thermo Scientific, USA).

RNA integrity was assessed using the Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Libraries were then constructed using the TruSeq Stranded Total RNA Library Prep

Kit (Illumina, USA) following the manufacturer’s instructions. Sequencing was performed on an Illumina Novaseq 6000 platform, generating 150 bp paired-end reads. Raw reads in fastq format

were firstly processed using fastp [41], and low-quality reads were removed to yield clean reads. These clean reads were mapped to the reference genome using HISAT2 [42]. Differential gene

expression was analyzed using the limma statistical package (version 3.26.9), as described at Bioconductor (http://www.bioconductor.org). Differentially expressed genes were defined by an

absolute log2(fold change) value > 0.5 and a _p-_value < 0.05. These genes were then compared with ferroptosis driver and suppressor genes from FerrDb website to identify intersectant

genes [43]. CELL CULTURE SRA 01/04 cells, sourced from Shanghai Jinyuan Biotechnology, were authenticated using STR DNA profiling. Cells were cultured in high glucose DMEM (11965092; Gibco)

supplemented with 10% FBS (SV30208; Cytiva) and 1% antibiotics (15140122; Gibco) in a humidified incubator at 37 °C and 5% CO2. Routine PCR testing for mycoplasma ensured the purity of the

cultures. To explore the influence of DDR2 on ferroptosis, we established DDR2-OE, YAP1-OE, and Src knockdown SRA 01/04 cell lines. DDR2-OE cells were established by transducing a lentivirus

carrying a DDR2-OE plasmid obtained from Genechem (Shanghai, China). Cells were selectively cultured with 2 μg/mL puromycin (ST551; Beyotime, Shanghai, China) to achieve stable

transduction. The YAP1 overexpressing cells were obtained by transiently transfected YAP1 with S127A mutation plasmids purchased from Genechem (Shanghai, China). The primers used for the

acquisition of the target gene fragment are: forward primer (5’ to 3’: CACACTGGACTAGTGGATCCCGCCACCATGGATCCCGGGCAG) and reverse primer (5’ to 3’:

AGTCACTTAAGCTTGGTACCGATAACCATGTAAGAAAGCTTTCTTTATC). Lipofectamine 3000 (L3000008; Thermo Scientific) and Opti-MEM (31985070, Gibco) were used in the transfection. After transfection, in some

cases, MG-132 (HY-13259; MCE, Shanghai, China) was added to inhibit proteosome function. The Src knockdown cells were obtained using Src targeted siRNAs purchased from Ribio Company

(Guangzhou, China). The sequences of siRNA-1 to siRNA-3 are GTTGTATGCTGTGGTTTCA, CTCGGCTCATTGAAGACAA and GAGAGAACCTGGTGTGCAA, respectively. For subsequent analysis, cells were harvested for

RNA extraction after 24 h and for protein extraction after 48 h. CELL VIABILITY Cell viability was assessed using the CCK-8 (C0037; Beyotime, China). Cells were seeded in 96-well plates

(5000 cells/well) for 24 h. The medium was then replaced with Erastin (HY-15763; MCE, Shanghai, China), RSL3 (HY-100218A; MCE), or inhibitors including Ferrostatin-1 (HY-100579; MCE),

Dasatinib (HY-10181; MCE), Saracatinib (HY-10234; MCE), Verteporfin (HY-B0146; MCE) at specific concentrations. After 10 µL of CCK-8 was added to each well for an hour, absorbance at 450 nm

was measured using a spectrophotometer (Tecan Spark, Tecan, Shanghai, China). Cells without treatment served as the negative control, while solutions containing DMEM and CCK-8 without cells

were used as blank control. Cell viability (%) = (A450, sample − A450, blank)/ (A450, control − A450, blank) × 100%. Hoechst 33342/PI (HO/PI) staining was performed using a staining kit

(C1056; Beyotime). Cells were cultured on confocal dishes before incubated with 5 µg/ml HO and 5 µg/ml PI at 37 °C, 5% CO2 for 15 min. Afterward, cells were washed and examined under a

fluorescence microscopy. Apoptotic cell death was analyzed by Annexin V/Propidium Iodide (PI) double staining kit (BL110A; Biosharp) by flow cytometry. Annexin V( − )PI(−), annexin V( + 

)PI(−), annexin V( + )PI(+), and annexin V( − )PI(+) cells were defined as viable, early apoptotic, late apoptotic, and necrotic cells, respectively. Intracellular caspase 3/7 was also

detected to assess apoptosis using a living cell detection agent (C10432; Thermofisher). INTRACELLULAR IRON AND LIPID PEROXIDATION Intracellular ferrous iron was stained using a 1 μM

solution of FerroOrange (F374; Dojindo, Japan). Capsules obtained from surgery were immediately spread on the confocal dish. After gently rinsing away the viscoelastic substance and being

exposed to corresponding treatments, they were covered with the working solution of FerroOrange and incubated for 30 min at 37 °C. Fluorography was then captured. A similar procedure was

applied to the SRA 01/04 cells. Each image was captured using the same exposure time. For lipid peroxidation analysis, C11-BODIPY 581/591 (HY-D1301; MCE) staining was conducted. Briefly, a

10 mM solution of C11-BODIPY was prepared in DMSO and then diluted in HBSS to achieve a final concentration of 10 μM. Cells or capsules were incubated in the working solution for 30 min at

37 °C. Fluorescence photos were captured under the emission wavelength of 525 nm and 624 nm. Quantitative data were analyzed using ImageJ (version 1.53k; National Institutes of Health,

Bethesda, MD, USA). Images were first split into color channels, and only channels of interest were processed further. Then a threshold was applied to exclude background signal.

Subsequently, the mean gray value within the threshold area was calculated using the “Measure” function. Each replicate came from the average value of three regions of interest that were

randomly selected. For Fe2+ analysis, to minimize batch effects between replicates, gray values from each replicate were normalized to the average gray value of the ARC group. For lipid

peroxidation analysis, the ratio of gray values between the FITC and TRITC channels was calculated to represent the degree of peroxidation. ROS, MDA AND GSH/ GSSG The

2’7’-dichlorodihydrofluorescein diacetate (DCFH-DA) kit (S0033S, Beyotime, Shanghai, China) was used to assess intracellular ROS levels. After treatment, cells were stained with 5 μM of

DCFH-DA at 37 °C for 30 min. Excess probe was then washed out and labeled cells were trypsinized and analyzed by a flow cytometry (MoFlo XDP; Beckman Coulter, USA). Results were analyzed

using the Flowjo software (version 10.8.1; https://www.flowjo.com/solutions/flowjo). MDA levels were measured using an MDA Content Test Kit (S0131S; Beyotime) following the manufacturer’s

instruction. The absorbance of each sample was measured at 532 nm, with the 450 nm absorbance serving as a reference. MDA concentration was normalized to the total protein content,

determined using the bicinchoninic acid (BCA) Protein Assay Kit (P0012; Beyotime). The GSH/GSSG ratio of lens cortex and nucleus was measured using a commercial kit (S0053; Beyotime)

according to the manufacturer’s protocol. The GSH or GSSG concentration was normalized to the wet weight of the tissue. QPCR Total RNA from the lens epithelial samples was extracted using

the Trizol reagent (15596018CN; Thermo Fisher Scientific), while that from cell lines was extracted using an RNA purification kit (EZB-RN4; EZBioscience, Roseville, CA, USA). RNA

quantitation and quality assessment were performed using a Nanodrop spectrophotometer (Thermo Fisher Scientific). Subsequently, RNA was reverse transcribed into cDNA using the HiFiScript

gDNA Removal RT Master Mix (CW2020M, Cowin Biosciences, Shanghai, China). The mRNA levels of selected genes were quantified by SYBR Green-based qPCR on a BioRad CFX96 real-time PCR machine.

The primer sequences used in this study are listed in the Supplemental Table 1. WESTERN BLOTTING Western blotting analysis was performed as previously described [14]. Briefly, cells or

tissues were collected and lysed in RIPA buffer containing 2% phosphatase and protease inhibitors (P1045, Beyotime, Shanghai, China). The capsule tissues were ground at −20 °C for 5 min to

make protein fully released. Lysates were centrifuged at 12000 × _g_ for 15 min, and the supernatants were collected. The Nucleoprotein Extraction Kit (C500009, Sangon, Shanghai, China) was

used to isolate the nucleic protein. Protein concentrations were determined using the BCA Protein Assay Kit as mentioned before. Proteins were separated by 4–12% SDS-PAGE and subsequently

transferred to PVDF membranes. The membranes were then blocked with 5% skimmed milk and incubated with primary antibodies under 4 °C overnight, followed by a 1 h incubation with horseradish

peroxidase-conjugated secondary antibodies the next day. Signal visualization and band intensity were assessed using chemiluminescence on an imaging system (Bio-Rad, Hercules, CA, USA). The

primary antibodies and dilution factors used are listed in Supplementary Table S2. CO-IP AND IP Co-IP was conducted according to the protocol provided with the Immunoprecipitation Kit

(P2179S, Beyotime). Briefly, cells were lysed using the cell lysis buffer and centrifuged at 12,000 × _g_ for 5 min at 4 °C. The supernatant was divided into two parts: one served as the

positive control (input), another was first incubated with magnetic beads combined with normal control IgG to reduce nonspecific binding. And then the supernatants were incubated with

magnetic bead conjugated with targeting antibodies. Subsequently, the beads were separated using a magnetic stand and washed with chilled lysis buffer for five times. To elute the

antigen-antibody complex, beads were heated at 99 °C in 1× loading buffer for 5 min. The supernatant after magnetic separation was then analyzed by Western blotting. DUAL-LUCIFERASE REPORTER

ASSAY Putative TEAD4 binding regions in the ACSL4 and TfR1 promoters were identified using the JASPAR database (https://jaspar.elixir.no/#). Target fragments were amplified via PCR and

inserted into the pGL3-basic luciferase reporter vector (GM-4629, Genomeditech, Shanghai, China) using seamless cloning. HEK-293 cells were co-transfected with TEAD4 plasmids and luciferase

reporter plasmids (wild type [WT] and mutative type [MT]) using Lipofectamine 2000 (ThermoFisher). After 48 h, cell lysates were collected and assayed using a Dual-Luciferase Assay kit

(GM-040502A, Genomeditech), following the manufacturer’s instruction. Luciferase activity was expressed as the ratio of firefly luciferase to renilla luciferase and normalized to the control

group. IMMUNOFLUORESCENCE Immunofluorescence was performed as described previously [38]. Briefly, cells seeded on a confocal dish were fixed in 4% paraformaldehyde, permeabilized with PBS

containing 0.5% Triton X-100, and blocked with 3% bovine serum albumin. Then cells were then probed overnight at 4 °C with antibodies against YAP1 and WWTR1, followed by incubation with a

secondary antibody at room temperature for 1 h. Fluorescence pictures were captured using a confocal microscopy (TCS SP5; Leica Microsystems, Germany). Fluorescence intensity of cytosol and

nucleus was measured using ImageJ. Specifically, the image was split into three channels (red, green, and blue). In the red channel, the entire cell region was selected using the “Threshold”

function and saved to the “Region of Interest” (ROI) manager. The nuclear region was identified in the DAPI (blue) channel and similarly added to the ROI manager. Then in the red channel,

cytoplasmic fluorescence intensity was calculated by subtracting the nuclear fluorescence intensity from the total cell fluorescence intensity. The nuclear-to-cytosol intensity ratio was

subsequently determined. CATARACT MODEL USING RSL3 We used anterior chamber injection of RSL3 to mimic the ferroptosis-related cataract formation. The anterior chamber injection protocol was

performed as described before [44]. Briefly, after surface anesthesia and pupil dilation, the cornea is punctured closely anterior to the iridocorneal angle using a 30-gauge needle. Then a

1 μL air bubble is created by a 34-gauge blunt needle fitted in a 5 μL micro syringe (Hamilton, Reno, NV, USA) to seal the puncture site. Subsequently, reagents were injected according to

the study design. The air bubble would be absorbed within 24 h. During the following days, optical photos after pupil dilation were taken under an operating microscope to record the opacity

of lens. The degree of cataract was quantified by calculating the ratio of the projected area of the nuclear opacity to the total projected area of cornea using the ImageJ software. The

optical coherence tomography (OCT) pictures were taken at the fifth day since injection using a swept-source OCT based biometer (YG-100 K, TowardPi Medical Technology Ltd, China).

STATISTICAL ANALYSIS Results are expressed as mean ± SD. Statistical analyses were conducted using GraphPad Prism software (version 8). The normality was assessed with the Shapiro-Wilk test.

The variance between the groups was assessed by the F test. Data from two groups were compared using two-tailed unpaired _t_-tests for unpaired experiments, or paired _t_-tests for

self-control mouse experiments. The False Discovery Rate method is used in multiple comparisons to control the number of false positives. Data from three or more groups were compared using

one-way ANOVA with the Dunnett’s multiple comparison test. A _P_-value < 0.05 was considered statistically significant. All results have been validated by three or more independent

experiments based on the information gathered from assays conducted previously by our group. Details of number of replicates are provided in the individual figure legends. DATA AVAILABILITY

The mRNA sequencing data used in this study have been deposited in the Gene Expression Omnibus (GEO) under the accession code GSE244037. Original data can be found in the “Supplemental

Material” part which is available at Cell Death & Disease’s website. REFERENCES * Holden BA, Fricke TR, Wilson DA, Jong M, Naidoo KS, Sankaridurg P, et al. Global prevalence of myopia

and high myopia and temporal trends from 2000 through 2050. Ophthalmology. 2016;123:1036–42. Article  PubMed  Google Scholar  * Lu Q, Du Y, Zhang Y, Chen Y, Li H, He W, et al. A genome-wide

association study for susceptibility to axial length in highly myopic eyes. Phenomics. 2023;3:255–67. Article  CAS  PubMed  Google Scholar  * Zhu X, Zhou P, Zhang K, Yang J, Luo Y, Lu Y.

Epigenetic regulation of αA-crystallin in high myopia-induced dark nuclear cataract. PLoS One. 2013;8:e81900. Article  PubMed  PubMed Central  Google Scholar  * Ying W. Phenomic studies on

diseases: Potential and challenges. Phenomics. 2023;3:285–99. Article  PubMed  PubMed Central  Google Scholar  * Zhu X, Li D, Du Y, He W, Lu Y. DNA hypermethylation-mediated downregulation

of antioxidant genes contributes to the early onset of cataracts in highly myopic eyes. Redox Biol. 2018;19:179–89. Article  CAS  PubMed  PubMed Central  Google Scholar  * Dixon SJ, Lemberg

KM, Lamprecht MR, Skouta R, Zaitsev EM, Gleason CE, et al. Ferroptosis: An iron-dependent form of nonapoptotic cell death. Cell. 2012;149:1060–72. Article  CAS  PubMed  PubMed Central 

Google Scholar  * Mi Y, Wei C, Sun L, Liu H, Zhang J, Luo J, et al. Melatonin inhibits ferroptosis and delays age-related cataract by regulating SIRT6/p-Nrf2/GPX4 and SIRT6/NCOA4/FTH1

pathways. Biomed Pharmacother. 2023;157:114048. * Wei Z, Hao C, Huangfu J, Srinivasagan R, Zhang X, Fan X. Aging lens epithelium is susceptible to ferroptosis. Free Radic Biol Med.

2021;167:94–108. Article  CAS  PubMed  PubMed Central  Google Scholar  * Kong D, Liu Y, Li L, Wang H, Li K, Zheng G. Astaxanthin ameliorates oxidative stress in lens epithelial cells by

regulating GPX4 and ferroptosis. Chem Biol Interact. 2023;383:110684. * Ma D, Liu J, Wang L, Zhi X, Luo L, Zhao J, et al. GSK-3β-dependent Nrf2 antioxidant response modulates ferroptosis of

lens epithelial cells in age-related cataract. Free Radic Biol Med. 2023;204:161–76. Article  CAS  PubMed  Google Scholar  * Simonelli F, Nesti A, Pensa M, Romano L, Savastano S, Rinaldi E,

et al. Lipid peroxidation and human cataractogenesis in diabetes and severe myopia. Exp Eye Res. 1989;49:181–7. Article  CAS  PubMed  Google Scholar  * Garner B, Roberg K, Qian M, Eaton JW,

Truscott RJW. Distribution of ferritin and redox-active transition metals in normal and cataractous human lenses. Exp Eye Res 2000;71:599–607. Article  CAS  PubMed  Google Scholar  *

Micelli-Ferrari T, Vendemiale G, Grattagliano I, Boscia F, Arnese L, Altomare E, et al. Role of lipid peroxidation in the pathogenesis of myopic and senile cataract. Br J Ophthalmol.

1996;80:840–3. Article  CAS  PubMed  PubMed Central  Google Scholar  * Zhu X, Du Y, Li D, Xu J, Wu Q, He W, et al. Aberrant TGF-β1 signaling activation by MAF underlies pathological lens

growth in high myopia. Nat Commun. 2021;12:2102. Article  CAS  PubMed  PubMed Central  Google Scholar  * Yu F, Zhao B, Guan K. Hippo pathway in organ size control, tissue homeostasis, and

cancer. Cell. 2015;163:811–28. Article  CAS  PubMed  PubMed Central  Google Scholar  * Halder G, Johnson RL. Hippo signaling: growth control and beyond. Development. 2011;138:9–22. Article 

CAS  PubMed  PubMed Central  Google Scholar  * Pan D. The hippo signaling pathway in development and cancer. Dev Cell. 2010;19:491–505. Article  CAS  PubMed  PubMed Central  Google Scholar 

* Lin CC, Yang WH, Lin YT, Tang X, Chen PH, Ding CKC, et al. DDR2 upregulation confers ferroptosis susceptibility of recurrent breast tumors. Oncogene. 2021;40:2018–34. Article  CAS  PubMed

  PubMed Central  Google Scholar  * Hsiao Y, Cao Y, Yue Y, Zhou J. Relationship between axial length and levels of TGF-β in the aqueous humor and plasma of myopic patients. Biomed Res Int.

2021;2021:8863637. Article  PubMed  PubMed Central  Google Scholar  * Ye S, Lawlor M, Rivera-Reyes A, Egolf S, Chor S, Pak K, et al. YAP1-mediated suppression of USP31 enhances NF-κB

activity to promote sarcomagenesis. Cancer Res. 2018;78:2705. Article  CAS  PubMed  PubMed Central  Google Scholar  * Ikeda K, Wang LH, Torres R, Zhao H, Olaso E, Eng FJ, et al. Discoidin

domain receptor 2 interacts with Src and Shc following its activation by type I collagen. J Biol Chem. 2002;277:19206–12. Article  CAS  PubMed  Google Scholar  * Bosch-Morell F, Sanz A,

Díaz-Llopis M, Romero FJ. Lipid peroxidation products in human subretinal fluid. Free Radic Biol Med. 1996;20:899–903. Article  CAS  PubMed  Google Scholar  * Chen J, Wu W, Wang Z, Zhai C,

Deng B, Alzogool M, et al. Novel corneal protein biomarker candidates reveal iron metabolic disturbance in high myopia eyes. Front Cell Dev Biol. 2021;9:689917. Article  PubMed  PubMed

Central  Google Scholar  * Lamar JM, Xiao Y, Norton E, Jiang ZG, Gerhard GM, Kooner S, et al. SRC tyrosine kinase activates the YAP/TAZ axis and thereby drives tumor growth and metastasis. J

Biol Chem. 2019;294:2302–17. Article  CAS  PubMed  Google Scholar  * Kim DH, Choi HI, Park JS, Kim CS, Bae EH, Ma SK, et al. Src-mediated crosstalk between FXR and YAP protects against

renal fibrosis. Faseb J. 2019;33:11109–22. Article  CAS  PubMed  Google Scholar  * Li P, Silvis MR, Honaker Y, Lien WH, Arron ST, Vasioukhin V. αE-catenin inhibits a Src–YAP1 oncogenic

module that couples tyrosine kinases and the effector of Hippo signaling pathway. Genes Dev. 2016;30:798–811. Article  CAS  PubMed  PubMed Central  Google Scholar  * Yang K, Kim JH, Kim HJ,

Park IS, Kim IY, Yang BS. Tyrosine 740 phosphorylation of discoidin domain receptor 2 by Src stimulates intramolecular autophosphorylation and Shc signaling complex formation. J Biol Chem.

2005;280:39058–66. Article  CAS  PubMed  Google Scholar  * Yang WH, Huang Z, Wu J, Ding CKC, Murphy SK, Chi JT. A TAZ-ANGPTL4-NOX2 axis regulates ferroptotic cell death and chemoresistance

in epithelial ovarian cancer. Mol Cancer Res. 2020;18:79–90. Article  CAS  PubMed  Google Scholar  * Wu J, Minikes AM, Gao M, Bian H, Li Y, Stockwell BR, et al. Intercellular interaction

dictates cancer cell ferroptosis via Merlin-YAP signalling. Nature. 2019;572:402–6. Article  CAS  PubMed  PubMed Central  Google Scholar  * He S, Li R, Peng Y, Wang Z, Huang J, Meng H, et

al. ACSL4 contributes to ferroptosis-mediated rhabdomyolysis in exertional heat stroke. J Cachexia Sarcopenia Muscle. 2022;13:1717–30. Article  PubMed  PubMed Central  Google Scholar  * Yang

WH, Lin CC, Wu J, Chao PY, Chen K, Chen PH, et al. The Hippo pathway effector YAP promotes ferroptosis via the E3 ligase SKP2. Mol Cancer Res. 2021;19:1005–14. Article  CAS  PubMed  PubMed

Central  Google Scholar  * Zhu G, Murshed A, Li H, Ma J, Zhen N, Ding M, et al. O-GlcNAcylation enhances sensitivity to RSL3-induced ferroptosis via the YAP/TFRC pathway in liver cancer.

Cell Death Discov. 2021;7:1–12. Article  Google Scholar  * Qin Y, Pei Z, Feng Z, Lin P, Wang S, Li Y, et al. Oncogenic activation of YAP signaling sensitizes ferroptosis of hepatocellular

carcinoma via ALOXE3-mediated lipid peroxidation accumulation. Front Cell Dev Biol. 2021;9:751593. Article  PubMed  PubMed Central  Google Scholar  * Kim S, Kang SW, Joo J, Han SH, Shin H,

Nam BY, et al. Characterization of ferroptosis in kidney tubular cell death under diabetic conditions. Cell Death Dis. 2021;12:160. Article  CAS  PubMed  PubMed Central  Google Scholar  *

Pei Z, Qin Y, Fu X, Yang F, Huo F, Liang X, et al. Inhibition of ferroptosis and iron accumulation alleviates pulmonary fibrosis in a bleomycin model. Redox Biol. 2022;57:102509. Article 

CAS  PubMed  PubMed Central  Google Scholar  * Xia YF, Wei J. Study on factors associated with high myopia CNV in aqueous humor and serum. Biomed Res Int. 2022;2022:8592729. Article  PubMed

  PubMed Central  Google Scholar  * Li H, Du Y, Cheng K, Chen Y, Wei L, Pei Y, et al. Gut microbiota-derived indole-3-acetic acid suppresses high myopia progression by promoting type I

collagen synthesis. Cell Discov. 2024;10:89. Article  CAS  PubMed  PubMed Central  Google Scholar  * Zhu X, Meng J, Han C, Wu Q, Du Y, Qi J, et al. CCL2-mediated inflammatory pathogenesis

underlies high myopia-related anxiety. Cell Discov. 2023;9:94. Article  CAS  PubMed  PubMed Central  Google Scholar  * Kubo E, Fatma N, Akagi Y, Beier DR, Singh SP, Singh DP. TAT-mediated

PRDX6 protein transduction protects against eye lens epithelial cell death and delays lens opacity. Am J Physiol Cell Physiol. 2008;294:C842–55. Article  CAS  PubMed  Google Scholar  *

Takashima M, Nagaya M, Takamura Y, Inatani M, Oki M. HIF-1 inhibition reverses opacity in a rat model of galactose-induced cataract. PLoS One. 2024;19:e0299145. Article  CAS  PubMed  PubMed

Central  Google Scholar  * Chen S, Zhou Y, Chen Y, Gu J. Fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics. 2018;34:i884–90. Article  PubMed  PubMed Central  Google Scholar

  * Kim D, Langmead B, Salzberg SL. HISAT: a fast spliced aligner with low memory requirements. Nat Methods. 2015;12:357–60. Article  CAS  PubMed  PubMed Central  Google Scholar  * Zhou N,

Yuan X, Du Q, Zhang Z, Shi X, Bao J, et al. FerrDb V2: update of the manually curated database of ferroptosis regulators and ferroptosis-disease associations. Nucleic Acids Res.

2023;51:D571–82. Article  CAS  PubMed  Google Scholar  * Bogner B, Boye SL, Min SH, Peterson JJ, Ruan Q, Zhang Z, et al. Capsid mutated adeno-associated virus delivered to the anterior

chamber results in efficient transduction of trabecular meshwork in mouse and rat. PLoS One. 2015;10:e0128759. Article  PubMed  PubMed Central  Google Scholar  Download references FUNDING

This article was supported by research grants from the National Natural Science Foundation of China (82271069, 82371040, 82122017, 81870642, 81970780, 81470613 and 81670835), Science and

Technology Innovation Action Plan of Shanghai Science and Technology Commission (23Y11909800), Outstanding Youth Medical Talents of Shanghai “Rising Stars of Medical Talents” Youth

Development Program, Shanghai Municipal Health Commission Project (2024ZZ1025 and 20244Z0015). AUTHOR INFORMATION Author notes * These authors contributed equally: Dongling Guo, Yu Du.

AUTHORS AND AFFILIATIONS * Eye Institute and Department of Ophthalmology, Eye & ENT Hospital, Fudan University, Shanghai, China Dongling Guo, Yu Du, Xin Liu, Dan Li, Ling Wei & 

Xiangjia Zhu * Key Laboratory of Myopia and Related Eye Diseases, NHC; Key Laboratory of Myopia and Related Eye Diseases, Chinese Academy of Medical Sciences, Shanghai, China Dongling Guo, 

Yu Du, Xin Liu, Dan Li, Ling Wei & Xiangjia Zhu * Shanghai Key Laboratory of Visual Impairment and Restoration, Shanghai, China Dongling Guo, Yu Du, Xin Liu, Dan Li, Ling Wei & 

Xiangjia Zhu * State Key Laboratory of Medical Neurobiology, Fudan University, Shanghai, China Dongling Guo, Yu Du, Xin Liu, Dan Li, Ling Wei & Xiangjia Zhu Authors * Dongling Guo View

author publications You can also search for this author inPubMed Google Scholar * Yu Du View author publications You can also search for this author inPubMed Google Scholar * Xin Liu View

author publications You can also search for this author inPubMed Google Scholar * Dan Li View author publications You can also search for this author inPubMed Google Scholar * Ling Wei View

author publications You can also search for this author inPubMed Google Scholar * Xiangjia Zhu View author publications You can also search for this author inPubMed Google Scholar

CONTRIBUTIONS Conceptualization, Xiangjia Zhu and Dongling Guo; Resources, Xiangjia Zhu; Methodology, Xin Liu and Dan Li; Validation, Dongling Guo and Ling Wei; Formal analysis, Dongling

Guo; Visualization, Dongling Guo; Writing—Original Draft Preparation, Dongling Guo and Yu Du; Writing—Review & Editing, Yu Du; Supervision, Xiangjia Zhu. CORRESPONDING AUTHOR

Correspondence to Xiangjia Zhu. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare no competing interests. ETHICAL APPROVAL This study received ethical approval from the Ethics

Committee of the Eye, Ear, Nose, and Throat (Eye & ENT) Hospital of Fudan University (approval number: 81470613, date of approval: 2020-06-01). All procedures adhered to the tenets of

the Declaration of Helsinki. Prior to surgery, written informed consents were obtained from all participants for the utilization of their clinical data and biological samples (lens

epithelium). Animal experiments were approved by the Animal Research Committee of the Eye & ENT Hospital of Fudan University and were aligned with the Guide for the Care and Use of

Laboratory Animals (National Institutes of Health, Bethesda, MD, USA). ADDITIONAL INFORMATION PUBLISHER’S NOTE Springer Nature remains neutral with regard to jurisdictional claims in

published maps and institutional affiliations. Edited by Boris Zhivotovsky SUPPLEMENTARY INFORMATION SUPPLEMENTARY FIGURES AND LEGENDS SUPPLEMENTAL TABLES ORIGINAL DATA FILE RIGHTS AND

PERMISSIONS OPEN ACCESS This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any

medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The

images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not

included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly

from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Reprints and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Guo, D., Du, Y.,

Liu, X. _et al._ Enhanced ferroptosis sensitivity promotes the formation of highly myopic cataract via the DDR2-Hippo pathway. _Cell Death Dis_ 16, 64 (2025).

https://doi.org/10.1038/s41419-025-07384-8 Download citation * Received: 30 August 2024 * Revised: 12 January 2025 * Accepted: 22 January 2025 * Published: 03 February 2025 * DOI:

https://doi.org/10.1038/s41419-025-07384-8 SHARE THIS ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link Sorry, a shareable link is not

currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative