Enhancement of parthenolide-induced apoptosis by a pkc-alpha inhibition through heme oxygenase-1 blockage in cholangiocarcinoma cells

ABSTRACT Cholangiocarcinoma (CC) is a chemoresistant intrahepatic bile duct carcinoma with a poor prognosis. The aims of this study were to identify molecular pathways that enhance

sesquiterpene lactone parthenolide (PTL)-induced anticancer effects on CC cells. The effects of PTL on apoptosis and hemoxygenase-1 (HO-1) induction were examined in CC cell lines. The

enhancement of PTL-mediated apoptosis by modulation of HO-1 expression and the mechanisms involved were also examined in an _in vitro_ cell system. Low PTL concentrations (5 to 10 µM) led to

Nrf2-dependent HO-1 induction, which attenuated the apoptogenic effect of PTL in Choi-CK and SCK cells. PTL-mediated apoptosis was enhanced by the protein kinase C-alpha inhibitor Ro317549

(Ro) through inhibition of expression and nuclear translocation of Nrf2, resulting in blockage of HO-1 expression. Finally, HO-1 silencing resulted in enhancement of apoptotic cell death in

CC cells. The combination of PTL and Ro efficiently improved tumor growth inhibition compared to treatment with either agent alone in an _in vivo_ subcutaneous tumor model. In conclusion,

the modulation of HO-1 expression substantially improved the anticancer effect of PTL. The combination of PTL and Ro could prove to be a valuable chemotherapeutic strategy for CC. SIMILAR

CONTENT BEING VIEWED BY OTHERS ARSENIC TRIOXIDE ENHANCES THE CHEMOTHERAPEUTIC EFFICIENCY OF CISPLATIN IN CHOLANGIOCARCINOMA CELLS VIA INHIBITING THE 14-3-3Ε-MEDIATED SURVIVAL MECHANISM

Article Open access 21 September 2020 TARGETING OXEIPTOSIS-MEDIATED TUMOR SUPPRESSION: A NOVEL APPROACH TO TREAT COLORECTAL CANCERS BY SANGUINARINE Article Open access 13 March 2023

JORUNNAMYCIN A INDUCES APOPTOSIS IN PANCREATIC DUCTAL ADENOCARCINOMA CELLS, SPHEROIDS, AND PATIENT-DERIVED ORGANOIDS BY MODULATING KRAS-MEDIATED SURVIVAL PATHWAYS Article Open access 03

April 2025 INTRODUCTION Cholangiocarcinoma (CC), a malignant tumor derived from the bile duct epithelium, currently accounts for approximately 15% of all cases of liver cancer worldwide, and

its incidence is rising (Blendis and Halpern, 2004; Shaib et al., 2004). The prognosis for CC is quite poor, with an average five-year survival rate of 5-10% due to the lack of early

diagnosis (de Groen et al., 1999) and relative resistance of the tumor to chemotherapy (Mittal et al., 1985; Pitt et al., 1995). Surgery is potentially curative, but only 25% of patients

have resectable tumors at diagnosis, and a majority of these patients relapse within two years (Vauthey and Blumgart, 1994). Generally, chemotherapeutic drugs exert their antitumor effects

by inducing apoptosis in cancer cells. Parthenolide (PTL), the major sesquiterpene lactone found in medicinal plants such as feverfew (_Tanacetum parthenium_) is known to inhibit IL-1- and

TNFα-mediated NF-κB activation; these are responsible for PTL's anti-inflammatory activity (Hwang et al., 1996; Bork et al., 1997). PTL also exhibits effective anticancer effects,

including the induction of apoptosis and growth arrest in sarcomatous hepatocellular carcinoma cells. Oxidative stress has been shown to contribute to PTL-induced apoptosis in a

glutathione-sensitive manner (Wen et al., 2002). Subsequent investigation of PTL activity has confirmed that it can induce apoptosis, indicating potential as an anticancer agent (Guzman et

al., 2005; Sweeney et al., 2005; Oka et al., 2007). Previously, we found that the sesquiterpene lactone, PTL, effectively induced apoptosis in CC cells through oxidative stress and that

susceptibility of CC cells to PTL is modulated by the Bcl-2-related family of proteins (Kim et al., 2005), however, the molecular mechanism behind PTL-induced apoptosis remains unclear.

Recently, we observed that heme oxygenase-1 (HO-1) was highly expressed during PTL-induced apoptosis in CC cells, and we propose that this induction may contribute to cellular resistance

against chemo-oxidative stress. A high dose of PTL alone or a low dose of PTL in combination with an effective inhibitor of HO-1 induction efficiently induces apoptosis by inhibition of HO-1

expression. HO-1 catalyzes the conversion of heme to carbon monoxide, iron, and biliverdin. It represents a prime cellular defense mechanism against oxidative stress _via_ the antioxidant

function of its catalytic products, such as bilirubin and carbon monoxide, and concomitant induction of iron-sequestering ferritin (Ryter and Choi, 2002). HO-1 overexpression in human

cancers may offer cancer cells a growth advantage and provide cellular resistance against chemotherapy and photodynamic therapy (Tanaka et al., 2003; Fang et al., 2004a). HO-1 induction by

stress-related agents has been reported to play a role in resistance to apoptosis in several types of human cancer cells (Liu et al., 2004; Sasaki et al., 2005). Similarly, inhibition of

HO-1 has been shown to reduce tumor growth and increased sensitivity to chemotherapy (Fang et al., 2003, 2004b). In the present study, we examined the molecular mechanisms by which PTL

induces apoptosis in CC cells through the modulation of HO-1 expression and explored which molecular pathways could be targeted to enhance this susceptibility. RESULTS HO-1 INDUCTION IS

ASSOCIATED WITH RESISTANCE OF CC CELLS TO PTL-INDUCED APOPTOSIS We previously found that 10 µM PTL effectively induced apoptotic cell death in a time- and dose-dependent manner in CC cells

in which oxidative stress plays a pivotal role in PTL-induced apoptosis (Kim et al., 2005). We examined whether HO-1 expression is correlated with susceptibility of CC cells to PTL. To do

this, we selected two CC cell lines: Choi-CK cells with low HO-1 expression and SCK cells with high HO-1 expression. PTL effectively triggered apoptotic cell death in a dose-dependent manner

in both cell lines (Figure 1A); 72 h treatment with 10 mM PTL induced cell death in 19.2% ± 0.2% of the Choi-CK cells and in 22.7% ± 0.7% of the SCK cells. Unexpectedly, apoptotic cell

death of SCK cells, which constitutively express HO-1, was significantly more pronounced than that of Choi-CK cells, suggesting that other molecular mechanism(s) may be involved in

PTL-mediated apoptosis. At a PTL concentration of 40 µM, the fraction of apoptotic cells abruptly increased to 55.7% in Choi-CK cells and 79.8% in SCK cells. During apoptosis, PTL induced

Nrf2-mediated HO-1 expression in a dose-dependent manner, except for in the case of treatment with high concentrations of PTL (Figure 1B). HO-1 induction was abruptly inhibited to basal

levels or below in CC cells treated with 40 µM PTL. Because this abrupt decrease may have resulted from the inhibition of Nrf2 expression or from its nuclear translocation, we examined

whether PTL treatment is associated with the nuclear translocation of Nrf2, an upstream transcriptional factor, in cells. The nuclear accumulation of Nrf2 peaked in cells treated with 5 to

10 µM PTL and decreased with higher concentrations. Cytoplasmic accumulation of Nrf2 was greater at lower concentrations, however, and less attenuated at the higher concentrations in both

cell lines (Figure 1C). These results suggest that PTL modulates nuclear translocation of Nrf2 at high concentrations of PTL and the expression of Nrf2 at low concentrations of PTL. To

determine whether ectopic expression of HO-1 modulated PTL-mediated apoptosis in CC cells, Choi-CK cells that stably expressed HO-1 were established and treated with the indicated

concentrations of PTL (Figure 1D). At 40 µM PTL, the fraction of apoptotic cells increased in the vector control cells but not in transfectants that stably express HO-1 (55.8% ± 3.6%

_versus_ 34.0% ± 4.0%). Ectopic overexpression of HO-1 appears to contribute to the resistance of CC cells to high PTL concentrations. PKCΑ INHIBITOR RO317549 INDUCED APOPTOSIS AND INHIBITED

NRF2-DEPENDENT HO-1 EXPRESSION To identify an agent that could simultaneously induce apoptosis and down-regulate HO-1, we examined various protein kinase inhibitors including PI3K inhibitor

LY294002, MEK1 inhibitor U0126, ERK inhibitor PD98059, and PKCα inhibitor Ro317549 (Ro), because several upstream signaling kinases, including PKC, PI3K, and MAPKs are known to be involved

in Nrf2 regulation (Martin et al., 2004; Kobayashi and Yamamoto, 2005). Choi-CK cells were treated with each of these inhibitors for 72 h. The PKCα inhibitor Ro induced apoptosis in a

dose-dependent manner much more effectively than did other inhibitors (Figure 2A) and decreased Nrf2 expression in a dose-dependent manner (Figure 2B). Ro did not enhance HO-1 expression in

Choi-CK cells, although other inhibitors did (Figure 2C). PI3K and MAPK inhibitors induced HO-1 expression, which seems to have resulted from the stress of signal inhibition. Furthermore, Ro

decreased Nrf2/HO-1 expression in a dose-dependent manner in SCK cells (Figure 2D). These results point to Ro as an ideal candidate for enhancement of PTL-mediated apoptosis in CC cells.

PKCΑ INHIBITOR RO ENHANCED PTL-MEDIATED APOPTOSIS IN CC CELLS Next, we treated CC cells with PTL alone or in combination with 5 µM Ro. Treatment with 2.5 µM Ro did not significantly increase

the apoptotic cell fraction in CC cells, as compared with other inhibitors. Ro significantly enhanced PTL-mediated apoptogenic effects in both Choi-CK (64.5% ± 3.2% _versus_ 47.4% ± 0.8%)

and SCK cells (88.5% ± 9.5% _versus_ 78.5% ± 5.2%) (Figure 3A). We also used FACScan analysis to determine the apoptotic cell fraction in Choi-CK cells treated with PTL alone or with 5 µM

and confirmed that Ro significantly enhanced PTL-mediated apoptogenic effects in Choi-CK cells (64.8% ± 7.2% _versus_ 49.3% ± 2.7%) (Figure 3B). Concomitant treatment with Ro and either 10

µM or 40 µM PTL attenuated Nrf2-dependent HO-1 expression in both Choi-CK and SCK cells (Figures 3C and D). Ro enhanced apoptosis in Choi-CK cells independently of HO-1 blockage at the

highest concentration (40 µM) of PTL. In addition, Ro-mediated Nrf2 inhibition was less remarkable than HO-1 inhibition at the low concentration of PTL (10 µM) in SCK cells. NUCLEAR PKCΑ

REGULATE HO EXPRESSION We found that SCK cells showed higher levels of expression and activation of PKCα than other CC cell lines (Figure 4A). Moreover, a transcriptional inhibitor Bach1

expression was much lower in SCK cells than in other CC cells, suggesting that down-regulation of Bach1 might be responsible for constitutive expression of HO-1. Accordingly, we examined the

effect of Bach1 on the promoter activity of HO-1 in SCK cells, and found that Bach1 effectively downregulated promoter activity of HO-1 to 21.5% of that attained with the mock transfection.

As a positive control, Nrf2 increased the promoter activity of HO-1 by 4.0-fold in Choi-CK cells (Supplemental Data Figure S1A). We also investigated whether ectopic expression of Bach1

altered the expression of other HO-1-modulating molecules. SCK cells stably expressing Bach1 showed suppressed expression of HO-1, but no change in the expression of PKCα or Nrf2

(Supplemental Data Figure S1B). The same results were obtained by immunofluoresence assay in SCK cells (Supplemental Data Figure S1C). The expression of PKCα was mainly localized in the

cytoplasm of SCK cells (Figure 4B). PKCα and constitutively active PKCα (MyrPKCα) led to Nrf2 expression and its nuclear translocation and subsequent HO-1 expression (Figure 4C). These

results indicate that nuclear PKCα translocation contributes to the constitutive expression of HO-1 in SCK cells. HO-1 SUPPRESSION INCREASED SUSCEPTIBILITY OF SCK CELLS TO PTL-MEDIATED

APOPTOSIS We assessed whether Bach1-mediated down-regulation of HO-1 or siRNA-mediated HO-1 silencing affected PTL-induced apoptosis in SCK cells. After treatment of SCK cells stably

expressing Bach1 with 10 µM PTL, apoptotic cell death increased significantly (_P_ < 0.01) to 34.3% or 31.3%, respectively, as compared to 13.8% or 16.2% in vector-treated control cells.

Treatment with 20 µM PTL also significantly enhanced apoptotic cell death in SCK cells stably expressing Bach1 to 53.7% or 50.9%, respectively, as compared with 26.7% or 30.1% in vector

control cells (Supplemental Data Figure S2). Furthermore, when the expression of HO-1 in SCK cells was inhibited to less than 20% of control levels using HO-1 siRNAs (Figure 5A), the level

of apoptotic cell death following treatment with 10 µM PTL was significantly higher in HO-1-silenced cells than in cells treated with non-targeting siRNA (25.8% or 31.0% _versus_ 16.6%; _P_

< 0.01). Similar enhanced apoptotic cell death was observed following treatment with 20 µM PTL, as compared to cells transfected with non-targeting siRNA (50.5% or 53.1% _versus_ 35.6%)

(Figure 5B). These findings suggest that both Bach1-mediated downregulation of HO-1 and HO-1 silencing by siRNA enhance PTL-induced apoptosis in CC cells. PKCΑ INHIBITOR RO INHIBITED

PTL-MEDIATED NRF2/HO-1 INDUCTION AND ENHANCED APOPTOSIS _IN VIVO_ To examine the effects of PTL and Ro on tumor growth _in vivo_, we used a xenograft nude mouse tumor model with

subcutaneously implanted Choi-CK and SCK cells. The animals that were simultaneously treated with PTL and Ro displayed significantly less tumor growth than the animals that were treated with

either PTL or Ro alone in the Choi-CK and SCK xenoplant models (_P_ < 0.01 and _P_ < 0.05, respectively, Figure 6A). We next investigated the effects of PTL and Ro on Nrf2 and HO-1

expression _in vivo_. PTL treatment induced Nrf2 and HO-1 expression, but concomitant treatment with Ro effectively inhibited PTL-mediated Nrf2 and HO-1 induction (Figure 6B). Because the

downregulation of HO-1 seemed to contribute to apoptotic cell death by PTL-mediated oxidative injury _in vitro_, representative tumors were analyzed with the TUNEL assay for the measurement

of apoptotic cells (Figure 6C). Tumor tissues from animals treated with PTL plus Ro displayed drastically more positively stained apoptotic cells, as compared to those from animals treated

with either PTL or Ro alone. Thus, both _in vitro_ and _in vivo_, Ro was able to suppress Nrf2 and HO-1 induction and subsequently induce apoptotic cell death in tumor tissues. DISCUSSION CC

cell sensitivity to PTL appears to be correlated with oxidative stress, which results mainly from GSH depletion and ROS generation (Kim et al., 2005). Overexpression or deletion of

antioxidant enzymes can alter the sensitivity of CC cells to PTL, substantiating the notion that the anticancer effects of PTL can be enhanced by suppression of antioxidant enzyme

expression. In the present study, we showed that typical CC cells express low levels of HO-1, whereas sarcomatous SCK cells constitutively express HO-1. Susceptibility to PTL was independent

of HO-1 basal level expression, and instead appeared to be associated with HO-1 expression that was inducible by drugs. In A549 cells, induction of HO-1 by oxidant chemicals or transfection

contributes to a cytoprotective effect (Lee et al., 1996; Speit and Bonzheim, 2003). In our study, a high dose of PTL caused inhibition of the expression and nuclear translocation of Nrf2

with subsequent blockage of HO-1 expression and enhanced apoptotic cell death in CC cells. Previous studies have shown that zinc protophorphyrin IX (ZnPP) inhibits HO-1 expression and

reduces tumor growth in mice in a dose dependent manner, whereas treatment with cobalt protoporphyrin IX (CoPP) increases HO-1 expression and enhances tumorigenicity (Hirai et al., 2007). In

the present study, we failed to enhance the PTL-mediated apoptogenic effect through the addition of ZnPP, which induced HO-1 expression in a dose-dependent manner (data not shown).

Therefore, we tested several kinase inhibitors and found that the PKCα inhibitor effectively induced apoptosis and simultaneously inhibited Nrf2-dependent HO-1 expression, even at low

concentrations of PTL. The PKC family of proteins comprises at least ten serine/threonine kinases (Rushworth et al., 2006). Among these, PKCα is known to phosphorylate Nrf2 at Ser40,

resulting in translocation of Nrf2 to the nucleus, where it forms a heterodimer and activates HO-1 gene expression (Bloom and Jaiswal, 2003). In the present study, the PKCα inhibitor reduced

both the expression and nuclear translocation of Nrf2, leading to HO-1 down-regulation. In contrast, neither PKCβ nor PKCδ inhibitor exerted effects on the inhibition of PTL-mediated HO-1

expression (data not shown). Other studies have shown that inhibition of PKCδ significantly decreases _HO-1_ mRNA induction (Ogborne et al., 2008; Zhang and Forman, 2008), whereas PKCα- and

β-specific inhibitors have no significant effect. The molecular mechanism of HO-1 modulation by PKC family members may be specific for each antioxidant. HO-1 induction also appears to be

related to the downregulation of the transcriptional inhibitor Bach1, a basic leucine zipper mammalian transcriptional repressor that forms antagonizing heterodimers with members of the

Maf-related oncogene family. These heterodimers bind to Maf recognition elements (MAREs) and suppress expression of various genes, including HO-1 and NQO1 (Sun et al., 2002, 2004).

Suppression or silencing of HO-1 resulted in increased susceptibility of tumor cells to PTL. Similarly, specific inhibition of HO-1 expression increases the response of pancreatic cancer to

anticancer treatment and enhances the cytotoxic effect of gemcitabine in urothelial cancer cells (Berberat et al., 2005; Miyake et al., 2010). Futhermore, PKC inhibition sensitizes TNFα- or

TRAIL-induced apoptosis in cancer cells (Nishida et al. 2003; Shi et al., 2005). Therefore, specific inhibition of HO-1 expression may be a new option in cancer chemotherapy. In summary,

although CC cells are intrinsically sensitive to PTL, substantial cytoprotective molecular mechanisms attenuate this susceptibility. PKCα inhibitors effectively enhanced PTL-mediated

apoptosis in CC cells by inhibition of the cytoprotective mechanisms both _in vitro_ and _in vivo_. Combining a PKCα inhibitor and PTL may be an effective clinical chemotherapeutic

application for CC. METHODS CELL CULTURE AND TRANSFECTION Four distinct CC cell lines (Choi-CK, Cho-CK, JCK1, and SCK) were cultured as described previously (Kim et al., 2005; Yoo et al.,

2009) and treated with 10 µM (or other concentrations as noted). PTL was dissolved in either dimethyl sulfoxide or absolute alcohol. Transfection of Choi-CK cells was performed using an

expression plasmid vector encoding the human HO-1 gene or a control vector (Invitrogen, Carlsbad, CA). Transfections were performed using Lipofectamine 2000 (Invitrogen) according to the

manufacturer's protocol, and transfectants were selected in the presence of 600 µg/ml G418 for 2-3 weeks. APOPTOSIS ASSAY BY FLOW CYTOMETRIC (FCM) ANALYSIS Trypsinized monolayer CC

cells and detached cells were collected at set intervals after treatment with PTL for analysis by FCM using a FACSCalibur (Becton Dickinson, San Jose, CA) with an argon laser at a wavelength

of 488 nm. Propidium iodide and 40 µg/100 µl phosphate buffered saline (PBS) were added to 1 × 106 cells suspended in 800 µl PBS together with 100 µl RNase A (1 µg/ml), and the mixture was

incubated at 37℃ for 30 min prior to FCM analysis of 2 × 104 cells, as described previously (Sasaki et al., 2005). The cell cycle was analyzed using ModFit LT 3.0 software program (Verity

Software House, Topsham, ME). The sub-G1 fraction was estimated by gating the hypodiploid cells in the DNA histogram using the LYSIS II program. CELL LYSIS AND IMMUNOBLOTTING Cells were

washed twice with cold PBS on ice and harvested by scraping with a rubber policeman. Cells were sedimented by centrifugation at 4℃ and resuspended directly into Laemmli sample buffer

containing 62.5 mM TrisHCl, pH 6.8, 2% SDS (w/v), 12% glycerol (w/v), and 5% mercaptoethanol (v/v). Extracted proteins were resolved by 12% SDS-PAGE and transferred to nylon membranes.

Membranes were incubated at 4℃ overnight with the primary antibody, washed in PBS/0.1% Tween and incubated for 45 min with the secondary antibody. Following incubation with the secondary

antibody, the blots were washed three times with PBS/0.1% Tween and developed using a commercial chemiluminescence detection kit (Amersham ECL). Nrf2 (C-20) and Bach1 (c-20) polyclonal

antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). HO-1 (SPA-896) polyclonal antibody was obtained from Stressgen (Ann Arbor, MI), and protein kinase C-α (PKCα)

polyclonal antibodies (2056) were purchased from Cell Signaling Tech (Danvers, MA). Polyclonal antibody against phosphorylated PKCα (S657, 06-822) was obtained from Upstate (Temecula, CA).

Monoclonal antibody to actin, anti-mouse IgG, anti-rabbit IgG, and anti-goat IgG were from Sigma (St. Louis, MO). IMMUNOFLUORESCENCE Cells were grown on glass coverslips, fixed with 4%

paraformaldehyde, permeabilized in PBS containing 0.2% Triton × 100, and blocked with 1% BSA. Transient transfection of a FLAG-PKCα fusion construct into Choi-CK cells was performed using

Lipofectamine 2000 (Invitrogen) according to the manufacturer's protocol. Cells were incubated with rabbit or mouse polyclonal antibodies against Nrf2 and HO-1, respectively, overnight

at 4℃, washed, and incubated with tetramethylrhodamine isothiocyanate isomer R (TRITC)-conjugated anti-rabbit immunoglobulin and fluorescein isothiocyanate-conjugated (FITC)-conjugated

anti-mouse immunoglobulin, respectively. After a final wash, the cells were stained for 15 min with 1 µg/ml Hoechst 33258 to visualize the nuclei and mounted in 50% glycerol in PBS at 4℃.

Cells were examined by laser scanning microscopy (LCM 510, Carl Zeiss, Jena, Germany). LUCIFERASE ASSAY The pGL3HO1/-4384-Luci construct, a human _HO-1_ promoter-driven luciferase reporter

construct spanning region -4384 to +24 of HO-1, was a gift from Prof. H.T. Chung (Wonkwang University School of Medicine, South Korea) (Lee et al., 2006). Cells were plated at 2 × 104

cells/well in 24-well plates and cultured for 18 h before a 16-h incubation at 37℃ with 500 ng pGL3HO1/-4384-Luci plasmid, 50 ng pRL-TK plasmid (Promega, Madison, WI), and Lipofectamine 2000

(Invitrogen). Following transfection, cells were replenished with complete medium, lysed in 120 µl lysis buffer at the indicated time intervals, and stored at -20℃ until assayed. Luciferase

activity was measured using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer's instructions and was normalized to Renilla luciferase activity. RNA

INTERFERENCE Small interfering RNA (siRNA) against _HO-1_ was procured from Qiagen (Hilden, Germany). Transfections with _HO-1_ siRNAs HMOX1-1 (target sequence CACCAAGTTCAAGCAGCTCTA) and

HMOX1-5 (target sequence CAGGCAATGGCCTAAACTTCA) were performed using HighPerFect Transfection Reagent (Qiagen) following the manufacturer's protocol. Cells were also transfected with

non-targeting, negative control siRNA (Qiagen, AllStar Negative Control siRNA) to assess target specificity and any non-specific gene silencing effects. Briefly, SCK cells were transfected

with 50 nM siRNAs directed against _HO-1_ for 72 h, and the cells were harvested and processed for cell lysate preparation. SUBCUTANEOUS TUMOR MODELS Choi-CK (4.5 × 106) and SCK (6.5 × 106)

cells were injected into nude mice (BALB/cByJ-_Hfh11_nu KRIBB, Daejeon, South Korea). Mice were randomized and assigned to treatment groups and intraperitoneally injected every other day

(200 µL) with diluent, PTL (2.5 mg/kg), Ro317549 (Ro, 2.5 mg/kg), or PTL + Ro, starting on days 14 and 28 day after tumor cell implantation (0.5 mm3 tumor volume), respectively. Tumor

diameters were measured at 3-day intervals, and tumor volumes were also calculated (width2 × length × 0.5). The experiment was terminated on days 38 and 56, respectively, and the tumors

harvested. All experiments were approved by the Chonbuk National University Animal Care and Use Committee. Apoptosis was measured quantitatively using the terminal deoxynucleotidyl

transferase (TdT)-mediated dUTP nick end-labeling (TUNEL) assay (Li and Altieri, 1999). All components for this procedure were from the ApopTag _in situ_ Apoptosis Detection kit (Chemicon,

Temecula, CA), which was used according to the manufacturer's instructions. Four fields at 40 × magnification were selected at the proliferation front of each tumor, and TUNEL-positive

cells were counted. QUANTIFICATION Densitometric data were analyzed using a LAS3000 system (Fuji Photo Film, Tokyo, Japan). Expression of each gene was calculated by normalizing the

expression level against the level of actin protein and then calculating the ratio of expression in treated cells as compared with that in control cells at the indicated time points.

STATISTICAL ANALYSIS Data are presented as mean ± SE of at least three independent experiments performed in duplicate. Representative blots are shown. All data were entered into Microsoft

Excel 5.0, and GraphPad Software was used to perform two-tailed t tests or analysis of the variance, as appropriate. _P_ values < 0.05 were considered significant. ABBREVIATIONS * CC:

cholangiocarcinomas * FCM: flow cytometry * HO-1: heme oxygenase-1 * PTL: parthenolide * Ro: Ro317549 * TUNEL: (TdT)-mediated dUTP nick end-labeling * ZnPP: zinc protophorphyrin IX

REFERENCES * Berberat PO, Dambrauskas Z, Gulbinas A, Giese T, Giese N, Künzli B, Autschbach F, Meuer S, Büchler MW, Friess H . Inhibition of Heme Oxygenase-1 Increases Responsiveness of

Pancreatic Cancer Cells to Anticancer Treatment . _Clin Cancer Res_ 2005 ; 11 : 3790 - 3798 Article  CAS  PubMed  Google Scholar  * Blendis L, Halpern Z . An increasing incidence of

cholangiocarcinoma: why ? _Gastroenterology_ 2004 ; 127 : 1008 - 1009 Article  PubMed  Google Scholar  * Bloom DA, Jaiswal AK . Phosphorylation of Nrf2 at Ser40 by protein kinase C in

response to antioxidants leads to the release of Nrf2 from INrf2, but is not required for Nrf2 stabilization/accumulation in the nucleus and transcriptional activation of antioxidant

response element-mediated NAD(P)H: quinone oxidoreductase-1 gene expression . _J Biol Chem_ 2003 ; 278 : 44675 - 44682 Article  CAS  PubMed  Google Scholar  * Bork PM, Schmitz ML, Kuhnt M,

Escher C, Heinrich M . Sesquiterpene lactone containing Mexican Indian medicinal plants and pure sesquiterpene lactones as potent inhibitors of transcription factor NF-kappaB . _FEBS Lett_

1997 ; 402 : 85 - 90 Article  CAS  PubMed  Google Scholar  * de Groen PC, Gores GJ, LaRusso NF, Gunderson LL, Nagorney DM . Biliary tract cancers . _N Engl J Med_ 1999 ; 341 : 1368 - 1378

Article  CAS  PubMed  Google Scholar  * Fang J, Sawa T, Akaike T, Akuta T, Sahoo SK, Khaled G, Hamada A, Maeda H . _In vivo_ antitumor activity of pegylated zinc protoporphyrin: targeted

inhibition of heme oxygenase in solid tumor . _Cancer Res_ 2003 ; 63 : 3567 - 3574 CAS  PubMed  Google Scholar  * Fang J, Akaike T, Maeda H . Antiapoptotic role of heme oxygenase (HO) and

the potential of HO as a target in anticancer treatment . _Apoptosis_ 2004a ; 9 : 27 - 35 Article  CAS  PubMed  Google Scholar  * Fang J, Sawa T, Akaike T, Greish K, Maeda H . Enhancement of

chemotherapeutic response of tumor cells by a heme oxygenase inhibitor, pegylated zinc protoporphyrin . _Int J Cancer_ 2004b ; 109 : 1 - 8 Article  CAS  PubMed  Google Scholar  * Guzman ML,

Rossi RM, Karnischky L, Li X, Peterson DR, Howard DS, Jordan CT . The sesquiterpene lactone parthenolide induces apoptosis of human acute myelogenous leukemia stem and progenitor cells .

_Blood_ 2005 ; 105 : 4163 - 4169 Article  CAS  PubMed  PubMed Central  Google Scholar  * Hirai K, Sasahira T, Ohmori H, Fujii K, Kuniyasu H . Inhibition of heme oxygenase-1 by zinc

protoporphyrin IX reduces tumor growth of LL/2 lung cancer in C57BL mice . _Int J Cancer_ 2007 ; 120 : 500 - 505 Article  CAS  PubMed  Google Scholar  * Hwang D, Fischer NH, Jang BC, Tak H,

Kim JK, Lee W . Inhibition of the expression of inducible cyclooxygenase and proinflammatory cytokines by sesquiterpene lactones in macrophages correlates with the inhibition of MAP kinases

. _Biochem Biophys Res Commun_ 1996 ; 226 : 810 - 818 Article  CAS  PubMed  Google Scholar  * Kim JH, Liu L, Lee SO, Kim YT, You KR, Kim DG . Susceptibility of cholangiocarcinoma cells to

parthenolide-induced apoptosis . _Cancer Res_ 2005 ; 65 : 6312 - 6320 Article  CAS  PubMed  Google Scholar  * Kobayashi M, Yamamoto M . Molecular mechanisms activating the Nrf2-Keap1 pathway

of antioxidant gene regulation . _Antioxid Redox Signal_ 2005 ; 7 : 385 - 394 Article  CAS  PubMed  Google Scholar  * Lee BS, Heo J, Kim YM, Shim SM, Pae HO, Kim YM, Chung HT . Carbon

monoxide mediates heme oxygenase 1 induction _via_ Nrf2 activation in hepatoma cells . _Biochem Biophys Res Commun_ 2006 ; 343 : 965 - 972 Article  CAS  PubMed  Google Scholar  * Lee PJ,

Alam J, Wiegand GW, Choi AM . Overexpression of heme oxygenase-1 in human pulmonary epithelial cells results in cell growth arrest and increased resistance to hyperoxia . _Proc Natl Acad Sci

USA_ 1996 ; 93 : 10393 - 10398 Article  CAS  PubMed  PubMed Central  Google Scholar  * Li F, Altieri DC . Transcriptional analysis of human survivin gene expression . _Biochem J_ 1999 ; 344

: 305 - 311 CAS  PubMed  PubMed Central  Google Scholar  * Liu ZM, Chen GG, Ng EK, Leung WK, Sung JJ, Chung SC . Upregulation of heme oxygenase-1 and p21 confers resistance to apoptosis in

human gastric cancer cells . _Oncogene_ 2004 ; 23 : 503 - 513 Article  CAS  PubMed  Google Scholar  * Martin D, Rojo AI, Salinas M, Diaz R, Gallardo G, Alam J, De Galarreta CM, Cuadrado A .

Regulation of heme oxygenase-1 expression through the phosphatidylinositol 3-kinase/Akt pathway and the Nrf2 transcription factor in response to the antioxidant phytochemical carnosol . _J

Biol Chem_ 2004 ; 279 : 8919 - 8929 Article  CAS  PubMed  Google Scholar  * Mittal B, Deutsch M, Iwatsuki S . Primary cancers of extrahepatic biliary passages . _Int J Radiat Oncol Biol

Phys_ 1985 ; 11 : 849 - 854 Article  CAS  PubMed  Google Scholar  * Miyake M, Fujimoto K, Anai S, Ohnishi S, Nakai Y, Inoue T, Matsumura Y, Tomioka A, Ikeda T, Okajima E, Tanaka N, Hirao Y .

Inhibition of heme oxygenase-1 enhances the cytotoxic effect of gemcitabine in urothelial cancer cells . _Anticancer Res_ 2010 ; 30 : 2145 - 2152 CAS  PubMed  Google Scholar  * Nishida S,

Yoshioka S, Kinoshita-Kimoto S, Kotani M, Tsubaki M, Fujii Y, Tomura TT, Irimajiri K . Pretreatment withPKC inhibitor triggers TNF-α induced apoptosis in TNF-α-resistant B16 melanoma BL6

cells . _Life Sci_ 2003 ; 74 : 781 - 792 Article  CAS  PubMed  Google Scholar  * Ogborne RM, Rushworth SA, O'Connell MA . Epigallocatechin activates haem oxygenase-1 expression _via_

protein kinase Cdelta and Nrf2 . _Biochem Biophys Res Commun_ 2008 ; 373 : 584 - 588 Article  CAS  PubMed  PubMed Central  Google Scholar  * Oka D, Nishimura K, Shiba M, Nakai Y, Arai Y,

Nakayama M, Takayama H, Inoue H, Okuyama A, Nonomura N . Sesquiterpene lactone parthenolide suppresses tumor growth in a xenograft model of renal cell carcinoma by inhibiting the activation

of NF-kappa B . _Int J Cancer_ 2007 ; 120 : 2576 - 2581 Article  CAS  PubMed  Google Scholar  * Pitt HA, Nakeeb A, Abrams RA, Coleman J, Piantadosi S, Yeo CJ, Lillemore KD, Cameron JL .

Perihilar cholangiocarcinoma. Postoperative radiotherapy does not improve survival . _Ann Surg_ 1995 ; 221 : 788 - 797 Article  CAS  PubMed  PubMed Central  Google Scholar  * Rushworth SA,

Ogborne RM, Charalambos CA, O'Connell MA . Role of protein kinase C delta in curcumin-induced anti-oxidant response element-mediated gene expression in human monocytes . _Biochem

Biophys Res Commun_ 2006 ; 341 : 1007 - 1016 Article  CAS  PubMed  Google Scholar  * Ryter SW, Choi AM . Heme oxygenase-1: molecular mechanisms of gene expression in oxygen-related stress .

_Antioxid Redox Signal_ 2002 ; 4 : 625 - 632 Article  CAS  PubMed  Google Scholar  * Sasaki T, Yoshida K, Kondo H, Ohmori H, Kuniyasu H . Heme oxygenase-1 accelerates protumoral effects of

nitric oxide in cancer cells . _Virchows Arch_ 2005 ; 446 : 525 - 531 Article  CAS  PubMed  Google Scholar  * Shaib YH, Davila JA, McGlynn K, El-Serag HB . Rising incidence of intrahepatic

cholangiocarcinoma in the United States: a true increase ? _J Hepatol_ 2004 ; 40 : 472 - 477 Article  PubMed  Google Scholar  * Shi RX, Ong CN, Shen HM . Protein kinase C inhibition and

x-linked inhibitor of apoptosis protein degradation contribute to the sensitization effect of luteolin on tumor necrosis factor-related apoptosis-inducing ligand-induced apoptosis in cancer

cells . _Cancer Res_ 2005 ; 65 : 7815 - 7823 Article  CAS  PubMed  Google Scholar  * Speit G, Bonzheim I . Genotoxic and protective effects of hyperbaric oxygen in A549 lung cells .

_Mutagenesis_ 2003 ; 18 : 545 - 548 Article  CAS  PubMed  Google Scholar  * Sun J, Hoshino H, Takaku K, Nakajima O, Muto A, Suzuki H, Tashiro S, Takahashi S, Shibahara S, Alam J, Taketo MM,

Yamamoto M, Igarashi K . Hemoprotein Bach1 regulates enhancer availability of heme oxygenase-1 gene . _EMBO J_ 2002 ; 21 : 5216 - 5224 Article  CAS  PubMed  PubMed Central  Google Scholar  *

Sun J, Brand M, Zenke Y, Tashiro S, Groudine M, Igarashi K . Heme regulates the dynamic exchange of Bach1 and NF-E2-related factors in the Maf transcription factor network . _Proc Natl Acad

Sci USA_ 2004 ; 101 : 1461 - 1466 Article  CAS  PubMed  PubMed Central  Google Scholar  * Sweeney CJ, Mehrotra S, Sadaria MR, Kumar S, Shortle NH, Roman Y, Sheridan C, Campbell RA, Murry

DJ, Badve S, Nakshatri H . The sesquiterpene lactone parthenolide in combination with docetaxel reduces metastasis and improves survival in a xenograft model of breast cancer . _Mol Cancer

Ther_ 2005 ; 4 : 1004 - 1012 Article  CAS  PubMed  Google Scholar  * Tanaka S, Akaike T, Fang J, Beppu T, Ogawa M, Tamura F, Miyamoto Y, Maeda H . Antiapoptotic effect of haem oxygenase-1

induced by nitric oxide in experimental solid tumour . _Br J Cancer_ 2003 ; 88 : 902 - 909 Article  CAS  PubMed  PubMed Central  Google Scholar  * Vauthey JN, Blumgart LH . Recent advances

in the management of cholangiocarcinomas . _Semin Liver Dis_ 1994 ; 14 : 109 - 114 Article  CAS  PubMed  Google Scholar  * Wen J, You KR, Lee SY, Song CH, Kim DG . Oxidative stress-mediated

apoptosis: The anticancer effect of the sesquiterpene lactone parthenolide . _J Biol Chem_ 2002 ; 277 : 38954 - 38964 Article  CAS  PubMed  Google Scholar  * Yoo HJ, Yun BR, Kwon JH, Ahn HS,

Seol MA, Lee MJ, Yu GR, Yu HC, Hong B, Choi K, Kim DG . Genetic and expression alterations in association with the sarcomatous change of cholangiocarcinoma cells . _Exp Mol Med_ 2009 ; 41 :

102 - 115 Article  CAS  PubMed  PubMed Central  Google Scholar  * Zhang H, Forman HJ . Acrolein induces heme oxygenase-1 through PKC-delta and PI3K in human bronchial epithelial cells . _Am

J Respir Cell Mol Biol_ 2008 ; 38 : 483 - 490 Article  PubMed  Google Scholar  Download references ACKNOWLEDGEMENTS The authors thank Prof. H.T. Chung and Prof. Y.J. Suh for providing

plasmids. This work was supported, in part, by a Korea Research Foundation grant from the Korean government (Basic Research Promotion Fund, KRF-2008-313-E00434), a research grant from the

Korean Association of Internal Medicine (1994), the Korea Health 21 R&D Project (A050328), the National R&D Program for Cancer Control, the Korean Health Technology R&D Project

(A101834), and the Ministry of Health, Welfare and Family Affairs (0620220), Republic of Korea. AUTHOR INFORMATION AUTHORS AND AFFILIATIONS * Division of Gastroenterology and Hepatology,

Department of Internal Medicine, Chonbuk National University Medical School and Hospital, Jeonju 561-712, Korea., Bo-Ra Yun, Mi-Jin Lee, Jong-Hyun Kim, In-Hee Kim, Goung-Ran Yu & 

Dae-Ghon Kim Authors * Bo-Ra Yun View author publications You can also search for this author inPubMed Google Scholar * Mi-Jin Lee View author publications You can also search for this

author inPubMed Google Scholar * Jong-Hyun Kim View author publications You can also search for this author inPubMed Google Scholar * In-Hee Kim View author publications You can also search

for this author inPubMed Google Scholar * Goung-Ran Yu View author publications You can also search for this author inPubMed Google Scholar * Dae-Ghon Kim View author publications You can

also search for this author inPubMed Google Scholar CORRESPONDING AUTHOR Correspondence to Dae-Ghon Kim. ADDITIONAL INFORMATION Supplementary Information accompanies the paper on the

Experimental & Molecular Medicine website SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION (PDF 217 KB) RIGHTS AND PERMISSIONS This is an Open Access article distributed under the

terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, and

reproduction in any medium, provided the original work is properly cited. Reprints and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Yun, BR., Lee, MJ., Kim, JH. _et al._ Enhancement of

parthenolide-induced apoptosis by a PKC-alpha inhibition through heme oxygenase-1 blockage in cholangiocarcinoma cells. _Exp Mol Med_ 42, 787–797 (2010).

https://doi.org/10.3858/emm.2010.42.11.082 Download citation * Accepted: 08 October 2010 * Published: 11 October 2010 * Issue Date: November 2010 * DOI:

https://doi.org/10.3858/emm.2010.42.11.082 SHARE THIS ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link Sorry, a shareable link is not

currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative KEYWORDS * cholangiocarcinoma * drug therapy * heme oxygenase-1 *

parthenolide * protein kinase C-α